Eupithecia interruptofasciata

Packard, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Eupithecia

At a glance

Occurrence records316

Data sources7

Biological traits0

DNA specimens5

eDNA detections2

Sources7 archives

Databases and archives Eupithecia interruptofasciata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility316 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF316 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD5 specimens

01Narrative

Eupithecia interruptofasciata là một loài bướm đêm trong họ Geometridae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eupithecia interruptofasciata has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.60%

Haplotypes2

BIN1

Most divergent pair0.76%

Where individuals differ — all 7 variable positions, in barcode order

67Avariable

85Cmostly conserved

199Gvariable

206Tvariable

223Cvariable

409Gvariable

604Cmostly conserved

AACCTTATATTTTATTTTTGGAATTTGAGCAGGCATAATTGGAACTTCTTTAAGATTACTAATTCGAGCCGAATTAGGAACCCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eupithecia pusillatasame genus2.6%Eupithecia rhoisatasame genus5.5%Eupithecia oxycedratasame genus5.6%Eupithecia abbreviatasame genus5.8%Eupithecia oranasame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type316 records

Wild obs. + sensor141

Museum / vouchered175

Range

Area of Occupancy AOO544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 89≤1 km 19≤10 km 3>10 km 5

116 georeferenced · 25 without coordinates

Open the mapobservation + sensor141

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 2≤1 km 12≤10 km 15>10 km 10

39 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence175

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	36
University of Guelph, Centre for Biodiversity Genomicslocation not on record	33
Helsinki, FI	22
East Lansing, US	11
New Haven, US	10
St. Paul, US	4
Cambridge, US	3
Centre for Biodiversity Genomicslocation not on record	2
Colorado State Universitylocation not on record	2
Cornell University Insect Collectionlocation not on record	1

10 institutions · 124 of 175 vouchered records shown · 51 without an institution code

09Environmental DNA2 detections

Where the DNA of Eupithecia interruptofasciata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.50 °C 0.5–16.5

Seasonal swing summer↔winter26.5 °C

Max temp (day)14.1 °C 4.90–23.2

Min temp (night)3.20 °C -3.60–10.0

Precipitation36.2 mm/mo 30.2–42.3

Air humidity56.4 % 52.0–60.7

Moisture balance-30.3 mm/mo -69.8–9.20

Vapour deficit631 Pa 300–962

Wind speed1.70 m/s 1.50–1.90

Cloud cover44.8 % 40.7–48.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)