Euphrosyne acerosa

(Nutt.) Panero · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Euphrosyne

At a glance

Occurrence records81

Data sources8

Biological traits8

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Euphrosyne acerosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility81 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF81 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Euphrosyne acerosa, commonly known as copperweed,US Department of Agriculture plants profile is a species of plant in the family Asteraceae.Nuttall, Thomas. 1848. Proceedings of the Academy of Natural Sciences of Philadelphia 4(1): 20 in EnglishTropicos, Oxytenia Nutt. It is native to the south-western United States (California (Inyo Co), Nevada (Nye Co), Utah, western Colorado, Arizona and north-western New Mexico).Flora of North America, Oxytenia acerosa Nuttall, Proc. Acad. Nat. Sci. Philadelphia. 4: 20. 1848.Biota of North America Program 2013 county distribution map, Euphrosyne acerosa

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass0.82 mg

Seed mass max0.82 mg

Seed mass min0.82 mg

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climberself-supporting

Growth formForb/herb, Shrub, Subshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphrosyne acerosa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF964033.1 ↗731 bpUSA

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCACAGCAGAACGACCCGTGAACAAGTAAAAACAC …

Euphrosyne acerosa isolate CBP247 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Euphrosyne acerosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 361×CCDB · eflora

CCDB · eflora

08Occurrence & distribution

Record type81 records

Wild obs. + sensor45

Museum / vouchered36

Origin

Native1

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 27≤10 km 2>10 km 11

40 georeferenced · 5 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤1 km 6≤10 km 7>10 km 2

15 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Riverside, US	14
Denver, US	7
San Diego, US	2
Provo, US	1
Davis, US	1
Claremont, US	1
Dekalb, US	1
San Luis Obispo, US	1
Los Angeles, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1

10 institutions · 30 of 36 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Euphrosyne acerosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)