Euphrasia stricta
J.P.Wolff ex J.F.Lehm. · speciesAt a glance
Occurrence records87 845
Data sources12
Biological traits40
DNA specimens37
eDNA detections24
Sources12 archives
Databases and archives Euphrasia stricta's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility87 845 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics37 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources40 traits
Chemical compositionLOTUS · NPASS26 compounds
Occurrence & distributionGBIF87 845 records
Environmental DNA1 datasets · 5 countries24 detections
DNA & barcodingBOLD · NCBI37 specimens
Genome at a glanceCCDB2n = 44
01Narrative
Euphrasia stricta, l’Euphraise raide, est une espèce de plantes à fleurs de la famille des Scrofulariacées selon la classification classique de Cronquist (1981), mais de la famille des Orobanchacées selon les classifications phylogénétiques APG II, APG III et APG IV. C'est une plante herbacée originaire d'Eurasie.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTWCVP
Size & morphology10
Leaf mass1.29 mg
Leaf size9.22 mm²
⚠ sources differ — TRY: 9.22 mm² · LEDA: 30.5 mm² · GIFT: 30.5 mm²
Plant height0.225 m
Plant height generative0.126 m
Plant height max0.5 m
Plant height min0.05 m
Seed length1.48 mm
Seed mass0.154 mg
⚠ sources differ — TRY: 0.154 mg · LEDA: 0.126 mg · GIFT: 0.133 mg
Seed mass max0.16 mg
Seed mass min0.066 mg
Life cycle & reproduction14
Deciduousnessaestival
Dehiscencedehiscent
Dispersal typeself
⚠ sources differ — LEDA: ballochor · GIFT: anemochorous
Flowering endOct
Flowering startJun
Life formhemiparasitic annual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formVascular semi-parasite
⚠ sources differ — LEDA: Vascular semi-parasite · GIFT: therophyte
Reproduction asexualabsent
Seed number61
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteobligatory
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTforest, forest edges, sand
Mycorrhiza type0.021602655
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)249 mg/g
⚠ sources differ — TRY: 249 mg/g · LEDA: 223 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)19.12 mm²/mg
⚠ sources differ — TRY: 19.12 mm²/mg · LEDA: 23.09 mm²/mg · GIFT: 23.09 mm²/mg
Other traits1
Diaspore typegerminule
03Chemical composition26 compounds
Compounds documented for Euphrasia stricta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavones6
Cinnamic acids and derivatives4
Chalcones3
Aminoacids3
Flavanones2
Documented compounds26 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Eriodictyol | present | NPASS | |
| (+)-Valine | present | LOTUS | |
| (2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[4-[(2S,3S)-3-(hydroxymethyl)-5-[(E)-3-hydroxyprop-1-enyl]-7-methoxy-2,3-dihydro-1-benzofuran-2-yl]-2-methoxyphenoxy]oxane-3,4,5-triol | present | LOTUS | |
| (3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | LOTUS | |
| (3S,8R,9R,10R,13R,14R,17R)-17-[(E,2S,5S)-5-ethyl-6-methylhept-3-en-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | LOTUS | |
| 2'-Methylisoliquiritigenin | present | NPASS | |
| 3-(3,4-Dihydroxyphenyl)Prop-2-Enoic Acid | present | LOTUS | |
| 3-(4-Hydroxy-3-Methoxyphenyl)Prop-2-Enoic Acid | present | LOTUS | |
| [(2R,3R,4R,5R,6R)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-2-(hydroxymethyl)-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(3-hydroxy-4-methoxyphenyl)prop-2-enoate | present | LOTUS | |
| [(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-(5-hydroxy-4-oxo-2-phenylchromen-7-yl)oxyoxan-2-yl]methyl acetate | present | NPASS |
05DNA & barcoding37 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphrasia stricta has left across the world's sequence archives.
At a glance
DNA specimens37
Marker genes6
GenBank sequences8
eDNA detections24
Countries7
The DNA barcodea real sequence read deposited for this species
CCTGCGGAGGATCATTGTGAAACNTGCAAAAGCAGACCGTGAACATGTCAAACCATTTGGGATCGAGGCGCGGGGGCAACCTCGCGCCGA …
Euphrasia stricta isolate 2009_118 internal transcribed spacer, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL2★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Euphrasia stricta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 44 n = 22
Ploidypolyploid inferred
Chromosome records22–442n range44median44mode16records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4414×CCDB · slov-fl · CCDB · nw-europe-fl · CCDB · fl-europaea +4
CCDB · slov-fl — Murín A., 1986: Karyological study of the Slovak flora XVIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 33: 85-92.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3680
CCDB · fl-europaea — Yeo, 1954
CCDB · ipcn-api-dl — Greilhuber, J., E. Vitek & F. Ehrendorfer. 1984. Evolution alpiner populationen von Euphrasia (Scrophulariaceae). Chromosomenzahlungen an diploiden und polyploiden sippen aus den Ostalpen. Pl. Syst. Evol. 144: 45–51.
CCDB · ipcn-api-dl — Murín, A. 1986. Karyological study of the Slovak flora XVIII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 85–92.
CCDB · book-ipcn67-71 — FAVARGER, c. 1969. Notes de caryologie Alpine V. Bull. Soc. Neuchateloise Sci. Nat. 92: 13-30.
CCDB · book-ipcn67-71 — FAVARGER, c. 1969. In IOPB chromosome number reports XXII. Taxon 18: 433-442.
CCDB · book-atlas-flowering-plants — Reese 1952a
CCDB · CromoCat 2015 — Greilhuber, J., E. Vitek & Ehrendorfer, F. (1984). Evolution alpiner populationen von Euphrasia (Scrophulariaceae). Chromosomenzahlungen an diploiden und polyploiden sippen aus den Ostalpen. Pl. Syst. Evol. 144: 45-51.
CCDB · CromoCat 2015 — Murín, A. (1986b). Karyological study of the Slovak flora XVIII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 85-92.
CCDB · CromoCat 2015 — Murín, A. (1986a). Karyological study of the Slovak flora XVIII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 85-91.
2n 222×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Van Den Brand, C., F. C. M. V. Meel & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 395–397.
CCDB · CromoCat 2015 — Den Brand, C., van, van Meel, F. C. M. & Wieffering, J. H. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 395-397.
n 223×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Greilhuber, J., E. Vitek & F. Ehrendorfer. 1984. Evolution alpiner populationen von Euphrasia (Scrophulariaceae). Chromosomenzahlungen an diploiden und polyploiden sippen aus den Ostalpen. Pl. Syst. Evol. 144: 45–51.
CCDB · CromoCat 2015 — Greilhuber, J., E. Vitek & Ehrendorfer, F. (1984). Evolution alpiner populationen von Euphrasia (Scrophulariaceae). Chromosomenzahlungen an diploiden und polyploiden sippen aus den Ostalpen. Pl. Syst. Evol. 144: 45-51.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type87 845 records
Wild obs. + sensor80 630
Museum / vouchered6 996
Cultivated / captive44
Other175
Origin
Native11
Introduced6
Range
Area of Occupancy AOO121 612 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy34% within 1 km
≤100 m 7 771≤1 km 14 026≤10 km 41 677>10 km 592
64 066 georeferenced · 16 564 without coordinates
Open the mapobservation + sensor80 630
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy56% within 1 km
≤100 m 786≤1 km 1 684≤10 km 1 731>10 km 209
4 410 georeferenced · 2 586 without coordinates
Open the institutions mapphysical evidence6 996
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 1
1 georeferenced · 43 without coordinates
Open the mapnot free-living44
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions80 of 160 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 818 |
| Olocation not on record | 531 |
| Moscow State Universitylocation not on record | 273 |
| IFR-DNFlocation not on record | 273 |
| Tartu, EE | 250 |
| Wlocation not on record | 235 |
| BFLlocation not on record | 227 |
| Uppsala, SE | 225 |
| Bergen, NO | 206 |
| Trondheim, NO | 199 |
| MeiseBGlocation not on record | 199 |
| Oulu, FI | 173 |
| TROMlocation not on record | 168 |
| BIO-UNIPIlocation not on record | 152 |
| Oskarshamn, SE | 151 |
| LDlocation not on record | 119 |
| Bern, CH | 116 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 104 |
| Mlocation not on record | 92 |
| Görlitz, DE | 92 |
| Barcelona, ES | 90 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 89 |
| Jyväskylä, FI | 69 |
| BRNUlocation not on record | 63 |
| Kuopio, FI | 61 |
| Salzburg, AT | 54 |
| Provincia di Livornolocation not on record | 50 |
| BDBClocation not on record | 50 |
| MAlocation not on record | 48 |
| KMNlocation not on record | 48 |
| Fulda, DE | 46 |
| St. Paul, US | 42 |
| SLU Artdatabankenlocation not on record | 42 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 42 |
| Zürich, CH | 41 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 40 |
| Garðabær, IS | 37 |
| GJOlocation not on record | 35 |
| Philadelphia, US | 34 |
| Adam Mickiewicz University in Poznańlocation not on record | 32 |
| Frankfurt am Main | 31 |
| Vitoria, ES | 31 |
| Uniwersytet Śląski w Katowicachlocation not on record | 31 |
| San Sebastián, ES | 30 |
| Tallinn, EE | 30 |
| València, ES | 28 |
| Natural History Museum Rotterdamlocation not on record | 27 |
| PRClocation not on record | 27 |
| Zürich, CH | 24 |
| PrivatHerblocation not on record | 23 |
| H-Adlerlocation not on record | 22 |
| Berlin, DE | 20 |
| Uniwersytet Warszawskilocation not on record | 20 |
| BClocation not on record | 18 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 18 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 16 |
| Saint John, CA | 16 |
| No collectionlocation not on record | 15 |
| nbflocation not on record | 14 |
| Toronto, CA | 13 |
| Ann Arbor, US | 12 |
| Karlsruhe, DE | 12 |
| Glarus, CH | 12 |
| Madison, US | 12 |
| Québec, CA | 12 |
| University of New Hampshirelocation not on record | 11 |
| CJBGlocation not on record | 9 |
| Burlington, US | 9 |
| DULlocation not on record | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 9 |
| Turku, FI | 8 |
| H-Schuhwlocation not on record | 8 |
| Lausanne, CH | 8 |
| NMBU:MINAlocation not on record | 7 |
| Naturalis Biodiversity Centerlocation not on record | 7 |
| Christchurch, NZ | 6 |
| Stockholm, SE | 6 |
| Rovaniemi, FI | 6 |
| John May Museum of Natural Historylocation not on record | 6 |
| DBF-NHMDlocation not on record | 6 |
| Wuzhou, CN | 6 |
| Entomological Society of Latvialocation not on record | 6 |
| TUR-Alocation not on record | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Acadia Universitylocation not on record | 5 |
| LfUlocation not on record | 5 |
| Porvoo, FI | 5 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 5 |
| NoColllocation not on record | 4 |
| H-AkrKGlocation not on record | 4 |
| Forssa, FI | 4 |
| Nijmegen, NL | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Tromso University Museumlocation not on record | 4 |
| Badajoz, ES | 4 |
| Chongqing Museumlocation not on record | 4 |
| Namur, BE | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| H-Dunkellocation not on record | 3 |
| Paris, FR | 3 |
| Xiamen, CN | 3 |
| Montréal, CA | 3 |
| Bronx, US | 3 |
| Vancouver, CA | 3 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 3 |
| Sion, CH | 3 |
| Salamanca, ES | 3 |
| Dresden, DE | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| Dekalb, US | 2 |
| FLADlocation not on record | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Boumlocation not on record | 2 |
| University of Alberta Museumslocation not on record | 2 |
| Chicago, US | 2 |
| SWlocation not on record | 2 |
| Boise, US | 2 |
| Podgorica, ME | 2 |
| Bourges, FR | 2 |
| Université Lavallocation not on record | 2 |
| GZUlocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| Pamplona, ES | 2 |
| JBRJlocation not on record | 1 |
| Chapel Hill, US | 1 |
| Dhaka, BD | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| OLAlocation not on record | 1 |
| Helsinki, FI | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Flagstaff, US | 1 |
| Durham, US | 1 |
| Whitehorse, CA | 1 |
| Tulane Universitylocation not on record | 1 |
| Moscow, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Porrentruy, CH | 1 |
| Pullman, US | 1 |
| Madrid, ES | 1 |
| Beijing, CN | 1 |
| McWane Science Centerlocation not on record | 1 |
| Provo, US | 1 |
| Göteborg, SE | 1 |
| South Kensington, GB | 1 |
| Oswego, US | 1 |
| Alicante, ES | 1 |
| 1 | |
| Taipei, TW | 1 |
| Brussel, BE | 1 |
| Logan, US | 1 |
| Ivano-Frankove, UA | 1 |
| Tula State Universitylocation not on record | 1 |
| Monastir, TN | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Pamplona, ES | 1 |
160 institutions · 6 435 of 6 996 vouchered records shown · 459 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Euphrasia stricta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.5 °C 12.0–17.2
Seasonal swing summer↔winter14.9 °C
Max temp (day)17.4 °C 13.7–20.3
Min temp (night)13.2 °C 8.40–15.0
Precipitation80.6 mm/mo 73.8–131
Air humidity63.1 % 61.1–63.8
Moisture balance-10.9 mm/mo
Vapour deficit682 Pa 510–740
Wind speed3.70 m/s
Cloud cover53.0 % 38.8–63.6
CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.