Euphrasia revoluta

Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Euphrasia

At a glance

Occurrence records365

Data sources5

Biological traits26

DNA specimens1

eDNA detections1

Sources5 archives

Databases and archives Euphrasia revoluta's data was compiled from.

GBIFGlobal Biodiversity Information Facility365 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF365 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology13

Fruit length7 mm

Fruit width4 mm

Leaf length max6 mm

Leaf width3 mm

Leaf width max3 mm

Leaf width min3 mm

Plant height max0.05 m

Seed length1.1 mm

Seed length max1.1 mm

Seed length min1.1 mm

Seed mass0 mg

Seed mass max0 mg

Seed mass min0 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeunspecialized

Life formhemiparasitic annual

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproduction asexualabsent

Habitat & environment4

Climatesubalpine or subarctic

Growth formherb

Habitat GIFTAlpine

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphrasia revoluta has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU029978.1 ↗618 bpNew Zealand

ACGT

GAAACCTGCAAAGCAGACCGTGAACATGTCAAACCATGGGATCGAGGCGGGGGGCAACCTCGCGCGAGTCCCTTCTCGTGCGCGTTCGTT …

Euphrasia revoluta isolate PAU-1a internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type365 records

Wild obs. + sensor222

Museum / vouchered143

Range

Area of Occupancy AOO844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 132≤1 km 47≤10 km 6>10 km 2

187 georeferenced · 35 without coordinates

Open the mapobservation + sensor222

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 10≤1 km 1

11 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence143

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	72
Wellington, NZ	43
Auckland, NZ	13
Wlocation not on record	12
Flagstaff, US	1
Chicago, US	1
Rotorua, NZ	1

7 institutions · 143 of 143 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Euphrasia revoluta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)