Euphrasia cambrica

Pugsley · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Euphrasia

At a glance

Occurrence records78

Data sources8

Biological traits8

DNA specimens6

eDNA detections2

Sources8 archives

Databases and archives Euphrasia cambrica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources8 traits

Occurrence & distributionGBIF78 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceGoaT2n = 44

01Narrative

Euphrasia cambrica is a plant from the genus Euphrasia, in the family Orobanchaceae. It is endemic to North Wales where it occurs on mountains in the vice-counties of Caernarfonshire and Merionethshire.Stace, Clive, (1997). The New Flora of The British Isles, Second Edition. Cambridge: Cambridge University Press

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology2

Leaf size32 mm²

Plant height0.08 m

Life cycle & reproduction2

Life formhemiparasitic annual

Life spanannual

Habitat & environment3

Climatetemperate

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphrasia cambrica has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH202551.1 ↗358 bp

ACGT

TTCGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTCCTATGTCCCATTCGTGTGGATAGAGCGTTGTGGGCGGAT …

Euphrasia cambrica isolate W_434 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Euphrasia cambrica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 441×GoaT · DTOL Flowering Plants Estimates Kew

GoaT · DTOL Flowering Plants Estimates Kew

08Occurrence & distribution

Record type78 records

Wild obs. + sensor70

Museum / vouchered8

Origin

Native64

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy7% within 1 km

≤100 m 5≤10 km 65

70 georeferenced

Open the mapobservation + sensor70

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museum Waleslocation not on record	2
South Kensington, GB	2

2 institutions · 4 of 8 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Euphrasia cambrica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 13.1–13.1

Seasonal swing summer↔winter10.6 °C

Max temp (day)15.7 °C

Min temp (night)9.80 °C

Precipitation142 mm/mo

Air humidity70.8 %

Moisture balance51.4 mm/mo

Vapour deficit443 Pa

Wind speed7.30 m/s

Cloud cover48.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)