Euphorbia triangularis

Desf. ex A.Berger · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records1 321

Data sources10

Biological traits16

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Euphorbia triangularis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 321 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS30 compounds

Occurrence & distributionGBIF1 321 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Euphorbia triangularis là một loài thực vật có hoa trong họ Đại kích. Loài này được Desf. ex A.Berger mô tả khoa học đầu tiên năm 1907 publ. 1906.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max15 m

Plant height min2.5 m

Life cycle & reproduction3

Life formsucculent tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 665 m

Elevation min5 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayCAM

⚠ sources differ — TRY: CAM · GIFT: C3

Other traits1

Plant support typefree-standing

03Chemical composition30 compounds

Compounds documented for Euphorbia triangularis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Tetracyclic diterpenoids $ Tigliane diterpenoids25

Pimarane and Isopimarane diterpenoids8

Lathyrane diterpenoids4

Jatrophane diterpenoids $ Lathyrane diterpenoids2

Lanostane, Tirucallane and Euphane triterpenoids1

Documented compounds30 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,4aR,4bS,8aS,10S,10aR)-2-ethenyl-2,4b,8,8-tetramethyl-1,3,4,4a,5,6,7,8a,9,10-decahydrophenanthrene-1,10,10a-triol	present	NPASS
(1R,4aS,4bR,7R,8R,8aR,9S,10aR)-7-ethenyl-8,8a,9-trihydroxy-1,4a,7-trimethyl-2,3,4,4b,5,6,8,9,10,10a-decahydrophenanthrene-1-carboxylic acid	present	NPASS
(1R,4aS,4bR,7R,8R,8aS,10aR)-7-ethenyl-8,8a-dihydroxy-1,4a,7-trimethyl-9-oxo-3,4,4b,5,6,8,10,10a-octahydro-2H-phenanthrene-1-carboxylic acid	present	NPASS
(1R,4aS,4bR,7S,8aR,10aR)-7-ethenyl-8a-hydroxy-1,4a,7-trimethyl-9-oxo-3,4,4b,5,6,8,10,10a-octahydro-2H-phenanthrene-1-carboxylic acid	present	NPASS
(1R,4aS,4bR,7S,8aR,10aR)-7-ethenyl-8a-hydroxy-1-(hydroxymethyl)-1,4a,7-trimethyl-3,4,4b,5,6,8,10,10a-octahydro-2H-phenanthren-9-one	present	NPASS
(1R,4aS,4bR,7S,8aR,9S,10aR)-7-ethenyl-8a,9-dihydroxy-1,4a,7-trimethyl-2,3,4,4b,5,6,8,9,10,10a-decahydrophenanthrene-1-carboxylic acid	present	NPASS
(4aS,4bR,7R,8R,8aS,10aS)-7-ethenyl-8,8a-dihydroxy-1,1,4a,7-tetramethyl-3,4,4b,5,6,8,10,10a-octahydro-2H-phenanthren-9-one	present	NPASS
12-Deoxy-phorbol-13-alpha-methylbutyrate-20-acetate	present	LOTUS
12-Deoxyphorbol 13-Isobutyrate	present	LOTUS
12-Deoxyphorbol 13-tiglate	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia triangularis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKC019600.1 ↗626 bp

ACGT

TCGAAGCCTACCCAACAGAATGACCCGTGAACATGTTTATAAATCGATGGGCTGCTGCGGGATTTATCCAGCATCAGCACCTCATTAGGG …

Euphorbia triangularis voucher Morawetz, J. J. 270 (MICH, NBG) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 321 records

Wild obs. + sensor1 244

Museum / vouchered77

Range

Area of Occupancy AOO2 164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 909≤1 km 76≤10 km 18>10 km 8

1 011 georeferenced · 233 without coordinates

Open the mapobservation + sensor1 244

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 77 records without

Open the institutions mapphysical evidence77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	50
Durban, ZA	20
Cape Town, ZA	5
University of Johannesburglocation not on record	2

4 institutions · 77 of 77 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Euphorbia triangularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 15.0–17.3

Seasonal swing summer↔winter9.30 °C

Max temp (day)21.3 °C 20.2–22.3

Min temp (night)11.1 °C 9.50–12.6

Precipitation34.1 mm/mo 32.7–35.5

Air humidity57.5 %

Moisture balance-58.5 mm/mo -66.8–-50.1

Vapour deficit782 Pa 727–838

Wind speed3.30 m/s 2.80–3.90

Cloud cover11.9 % 11.7–12.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euphorbia triangularis

At a glance

Sources10 archives

Size & morphology2

Life cycle & reproduction3

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

Other traits1

Compound class profile5 classes

Documented compounds30 total

At a glance

Record type1 321 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 321 records