Euphorbia terracina
speciesAt a glance
Occurrence records13 809
Data sources14
Biological traits56
DNA specimens7
eDNA detections4
Sources14 archives
Databases and archives Euphorbia terracina's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 809 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics7 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources56 traits
Chemical compositionLOTUS · NPASS65 compounds
Occurrence & distributionGBIF13 809 records
Environmental DNA1 datasets · 2 countries4 detections
DNA & barcodingBOLD · NCBI7 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2n = 18
01Narrative
Euphórbia terracína (лат.) — вид двудольных цветковых растений, относящийся к роду Молочай семейства Молочайные (Euphorbiaceae). Многолетнее или двулетнее растение с толстоватыми мелкозубчатыми листьями и метёлками жёлтых циатиев.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology27
Fruit length3.5 mm
Fruit length max3.7 mm
Fruit length min2.5 mm
Fruit width4.5 mm
Fruit width max4.6 mm
Fruit width min3 mm
Inflorescence length max0.25 cm
Inflorescence length min0.1 cm
Leaf length27.5 mm
Leaf length max60 mm
Leaf length min4 mm
Leaf mass per area49.73 g/m2
Leaf width8 mm
Leaf width max13 mm
Leaf width min2 mm
Plant height0.5 m
⚠ sources differ — AusTraits: 0.5 m · TRY: 0.212 m
Plant height max0.9 m
Plant height min0.05 m
Seed length2.5 mm
Seed length max2.4 mm
Seed length min1.6 mm
Seed mass2.6 mg
Seed mass max2.6 mg
Seed mass min2.6 mg
Seed width2.5 mm
Seed width max1.8 mm
Seed width min1.3 mm
Life cycle & reproduction10
Dehiscencedehiscent
Flower colourred
Flowering endOct
Flowering startFeb
Flowering timeyynnnnnnnnny
Life formsubshrub
Life spanperennial
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Sex typemonoecious
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max300 m
Elevation min0 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapelanceolate linear ovate triangular
Mycorrhiza type0.0000000282
Woodinesswoody
⚠ sources differ — TRY: woody · AusTraits: herbaceous woody_base · GIFT: non-woody
Physiology & chemistry3
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)27.9 mm²/mg
Other traits2
Plant support typefree-standing
Shoot orientationascending
03Chemical composition65 compounds
Compounds documented for Euphorbia terracina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Jatrophane diterpenoids25
Oleanane triterpenoids12
Tigliane diterpenoids6
Cinnamic acids and derivatives6
Plant xanthones3
Documented compounds65 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,5S,6E,8R,10R)-6-[(4-hydroxy-3,5-dimethoxyphenyl)methylidene]-4,9,12-trioxatetracyclo[6.5.1.01,10.05,10]tetradecane-7,13-dione | present | NPASS | |
| (1S,5S,6E,8R,10R)-6-[(4-hydroxy-3-methoxyphenyl)methylidene]-4,9,12-trioxatetracyclo[6.5.1.01,10.05,10]tetradecane-7,13-dione | present | NPASS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-3-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-8a-[(2S,3R,4S,5R,6R)-3-[(2S,3R,4S,5R,6S)-3,4-dihydroxy-6-methyl-5-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | NPASS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5R,6R)-5-acetyloxy-3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-4-hydroxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | NPASS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5R,6R)-5-acetyloxy-3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-4-hydroxy-6-methyloxan-2-yl]oxycarbonyl-3-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | NPASS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-4,5-diacetyloxy-3-[(2S,3R,4S,5R,6S)-3,4-dihydroxy-6-methyl-5-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-6-methyloxan-2-yl]oxycarbonyl-3-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | NPASS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-4,5-diacetyloxy-3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | NPASS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-4,5-diacetyloxy-3-[(2S,3R,4S,5S,6S)-4-[(2S,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-5-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3-hydroxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxycarbonyl-3-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | NPASS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-4,5-diacetyloxy-3-[(2S,3R,4S,5S,6S)-4-[(2S,3R,4S)-4-(acetyloxymethyl)-3,4-dihydroxyoxolan-2-yl]oxy-5-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3-hydroxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | NPASS | |
| (2S,3R,4S,4aR,6aR,6bR,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-4,5-diacetyloxy-3-[(2S,3R,4S,5S,6S)-4-[(2S,3R,4S)-4-(acetyloxymethyl)-3,4-dihydroxyoxolan-2-yl]oxy-5-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3-hydroxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxycarbonyl-3-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-hydroxy-6b-(hydroxymethyl)-4,6a,11,11,14b-pentamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | NPASS |
05DNA & barcoding7 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia terracina has left across the world's sequence archives.
At a glance
DNA specimens7
Marker genes4
GenBank sequences10
eDNA detections4
Countries3
The DNA barcodea real sequence read deposited for this species
GATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACGCGTTTATAAACCGAGGGATCGCCGTCGGATTCGTCCGGAGTCGGTCCCT …
Euphorbia terracina isolate CDA-0053785 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcLa★ITS10★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Euphorbia terracina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–362n range18median18mode28records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1826×GoaT · Tree of Sex Database · CCDB · ita-fl · CCDB · iapt +6
GoaT · Tree of Sex Database — ↗
CCDB · ita-fl — PAVONE P., TERRASI M.C., ZIZZA A. - 1981. Chromosome number reports LXXII.. Taxon , 30(3): 695-696.
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · iber-fl — Contribucin al estudio cariolgico del gnero Euphorbia L., subgn. Esula Pers. Juan, R. & J. Pastor.Bol. Soc. Brot. ser. 266: 41-54(1993).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XI. Euphorbiaceae Queirs, M.Bol. Soc. Brot. ser. 249: 143-161(1975).
CCDB · iber-fl — Estudio citotaxonmico de la flora de las costas gallegas Lago Canzobre, E. & S. Castroviejo.Cadernos rea Ci. Biol.3: 1-215(1993).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 225-239. Garca, I. & B. Valds.Lagascalia10(2): 241-247(1981).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 45-59. Oliva, R.Lagascalia8(1): 105-109(1978).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · ipcn-api-dl — Queiros, M. 1975a. Contribuicao para o conhecimento citotaxonomico das Spermatophyta de Portugal. XI. Euphorbiaceae. Bol. Soc. Brot., sér. 2 49: 143–161.
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · book-atlas-flowering-plants
CCDB · CromoCat 2015 — Dahlgren, R., Karlsson, Th. & Lassen, P. (1971). Studies on the Flora of the Balearic Islands, I. Chromosome numbers in Balearic Angiosperms. Bot. Not. 124(1): 249-269.
CCDB · CromoCat 2015 — Dalgaard, V. (1986a). Chromosome studies in flowering plants from Macaronesia. Anales Jard. Bot. Madrid 43: 83-111.
CCDB · CromoCat 2015 — Dalgaard, V. (1986b). Chromosome numbers in flowering plants from Madeira. Willdenowia 16: 221-240.
CCDB · CromoCat 2015 — Fiorini, G. & Raffaelli, M. (1990). Números cromosomáticos de plantas occidentales, 602-607. Anales Jard. Bot. Madrid 47: 419-423.
CCDB · CromoCat 2015 — García, I. & Valdés, B. (1981). Números cromosómicos para la flora española, 225-239. Lagascalia 10(2): 241-247
CCDB · CromoCat 2015 — Lago, E. & Castroviejo, S. (1993). Estudio citotaxonómico de la flora de las costas gallegas. Cadernos Área Ci. Biol. 3: 1-215.
CCDB · CromoCat 2015 — Oliva, R. (1978). Números cromosómicos para la flora española, 45-59. Lagascalia 8(1): 105-109.
CCDB · CromoCat 2015 — Pavone, P., C. M. Terrasi & A. Zizza. (1981b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 695-696.
CCDB · CromoCat 2015 — Perry, B. A. (1943). Chromosome numbers and phylogenetic relationships in the Euphorbiaceae. Amer. J. Bot. 30: 527-543.
CCDB · CromoCat 2015 — Queirós, M. (1975b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XI. Euphorbiaceae. Bol. Soc. Brot. 49: 143-161.
CCDB · CromoCat 2015 — Vicens, J. & J. Molero. (1992). In: G. Kamari, F. Felber & F. Garbari (Eds.), Mediterranean chromosome number reports, 70-78. Fl. Medit. 2: 243-247.
CCDB · CromoCat 2015 — Vogt, R. & Oberprieler, C. (2009). IAPT/IOPB Chromosome Data 8 Taxon 58 (4): 1282-1283
TreeOfSex · plant — Goldblatt1979 ↗
2n 201×CCDB · kew
CCDB · kew — Suda J, Kyncl T, Jarolimova V. 2005. Genome size variation in Macaronesian angiosperms: forty percent of the Canarian endemic flora completed. Plant Systematics and Evolution 252: 215-238.
2n 361×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Dalgaard, V. (1986a). Chromosome studies in flowering plants from Macaronesia. Anales Jard. Bot. Madrid 43: 83-111.
n 95×CCDB · ita-fl · CCDB · iber-fl · CCDB · CromoCat 2015 +1
CCDB · ita-fl — D'AMATO F. - 1946. Nuove ricerche embriologiche e cariologiche sul genere Euphorbia.. N. Giorn. Bot. Ital., n.s. , 53(3-4): 405-436.
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 225-239. Garca, I. & B. Valds.Lagascalia10(2): 241-247(1981).
CCDB · CromoCat 2015 — García, I. & Valdés, B. (1981). Números cromosómicos para la flora española, 225-239. Lagascalia 10(2): 241-247
CCDB · CromoCat 2015 — Pavone, P., C. M. Terrasi & A. Zizza. (1981b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 695-696.
TreeOfSex · plant — Goldblatt1979 ↗
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.952 ↗
08Occurrence & distribution
Record type13 809 records
Wild obs. + sensor11 790
Museum / vouchered1 894
Other125
Origin
Native1 822
Introduced1 933
Range
Area of Occupancy AOO19 248 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy74% within 1 km
≤100 m 3 763≤1 km 3 739≤10 km 2 454>10 km 136
10 092 georeferenced · 1 698 without coordinates
Open the mapobservation + sensor11 790
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy58% within 1 km
≤100 m 186≤1 km 453≤10 km 431>10 km 25
1 095 georeferenced · 799 without coordinates
Open the institutions mapphysical evidence1 894
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions51 of 83 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Adelaide, AU | 342 |
| MAlocation not on record | 141 |
| Paris, FR | 103 |
| Kensington, AU | 97 |
| Barcelona, ES | 90 |
| València, ES | 89 |
| College of the Atlantic, Museumlocation not on record | 61 |
| BIO-UNIPIlocation not on record | 58 |
| Alicante, ES | 50 |
| BDBClocation not on record | 43 |
| BClocation not on record | 41 |
| LDlocation not on record | 40 |
| Canberra, AU | 39 |
| Museo Entomologico de Leonlocation not on record | 34 |
| UIBlocation not on record | 30 |
| Canadian Department of Agriculturelocation not on record | 29 |
| Cape Town, ZA | 26 |
| Phyletisches Museum Jenalocation not on record | 24 |
| Riverside, US | 24 |
| Entomological Society of Latvialocation not on record | 21 |
| Brisbane, AU | 20 |
| Wlocation not on record | 20 |
| Granada, ES | 19 |
| Santa Barbara, US | 16 |
| Mount Annan, AU | 16 |
| CICYTEXlocation not on record | 16 |
| San Diego, US | 15 |
| Salamanca, ES | 15 |
| Claremont, US | 14 |
| Berlin, DE | 13 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 12 |
| Pretoria, ZA | 12 |
| Saint Louis, US | 11 |
| Badajoz, ES | 11 |
| Córdoba, ES | 10 |
| South Kensington, GB | 10 |
| BRNUlocation not on record | 9 |
| Chicago, US | 9 |
| EEZA-CSIClocation not on record | 8 |
| ISAlocation not on record | 7 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 7 |
| BGPAlocation not on record | 7 |
| Madrid, ES | 7 |
| Irvine, US | 6 |
| Vitoria, ES | 6 |
| CJBGlocation not on record | 5 |
| Sevilla, ES | 5 |
| Los Angeles, US | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Mexico City, MX | 5 |
| Oskarshamn, SE | 4 |
| PRClocation not on record | 4 |
| Austin, US | 4 |
| Philadelphia, US | 3 |
| Durango, MX | 3 |
| Frankfurt am Main | 3 |
| Northridge, US | 3 |
| CASlocation not on record | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| MeiseBGlocation not on record | 3 |
| San Sebastián, ES | 2 |
| Jaén, ES | 2 |
| Davis, US | 2 |
| Ann Arbor, US | 2 |
| Logan, US | 2 |
| Hobart, AU | 2 |
| GB | 1 |
| University of Stellenboschlocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| EL PASO, US | 1 |
| Kew, GB | 1 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 1 |
| Palmerston, AU | 1 |
| ASUlocation not on record | 1 |
| Monastir, TN | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Phoenix, US | 1 |
| Bronx, US | 1 |
| Rishon Le Zion, IL | 1 |
| Fort Worth, US | 1 |
83 institutions · 1 765 of 1 894 vouchered records shown · 127 without an institution code
09Environmental DNA4 detections
Where the DNA of Euphorbia terracina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map2 countries0
Vernal pool/Quino habitat restoration, occur…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.2 °C 15.0–15.2
Seasonal swing summer↔winter21.1 °C
Max temp (day)20.1 °C 19.1–20.1
Min temp (night)9.00 °C 9.00–11.0
Precipitation33.4 mm/mo 22.8–33.4
Air humidity52.9 % 52.9–58.1
Moisture balance-61.7 mm/mo -86.9–-61.7
Vapour deficit953 Pa 745–953
Wind speed2.00 m/s 1.60–2.00
Cloud cover38.3 % 29.2–38.3
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.