Euphorbia tardieuana — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records2

Data sources9

Biological traits9

DNA specimens5

eDNA detections5

Sources9 archives

Databases and archives Euphorbia tardieuana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF2 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Euphorbia tardieuana is a species of plant in the family Euphorbiaceae. It is endemic to Madagascar. Its natural habitat is rocky areas. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Succulenceyes

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia tardieuana has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences6

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSKF409425.1 ↗664 bp

ACGT

ACCTGCCCAGCAGAATGACCTGCGAACATGTTTATAATTTGAGGCGCTGCTACTGGATCTATCCAGTGTCGGTACCCTCACCAAGGCCTG …

Euphorbia tardieuana voucher Gerold s.n. 2008BG00925 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2rbcL2ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	2

1 institutions · 2 of 2 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Euphorbia tardieuana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.