Euphorbia squamosa

Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records466

Data sources10

Biological traits15

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Euphorbia squamosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility466 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionNPASS8 compounds

Occurrence & distributionGBIF466 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Euphorbia squamosa is a species of plant in the family Euphorbiaceae. It is endemic to Iran, Russia, Georgia, Armenia, Azerbaijan, and Turkey.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.8 m

Plant height min0.27 m

Life cycle & reproduction5

Flowering endJun

Flowering startJun

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest edges, shrubberies

Mycorrhiza typearbuscular

Woodinessnon-woody

03Chemical composition8 compounds

Compounds documented for Euphorbia squamosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Jatrophane diterpenoids2

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
[(1S,2S,3aR,5S,6E,9S,10S,11S,13R,13aR)-1,3a,9,10,11-pentaacetyloxy-2,5,8,8-tetramethyl-12-methylidene-4-oxo-2,3,5,9,10,11,13,13a-octahydro-1H-cyclopenta[12]annulen-13-yl] benzoate	present	NPASS
AFISOGZFAVCZMD-WNRYSBCWSA-N	present	NPASS
Euphoscopin C	present	NPASS
HLGQJIRIVJLKET-PISILSIWSA-N	present	NPASS
IFUGWILNBFHLFO-IMYARSFSSA-N	present	NPASS
MGQBTBLHNLYVIS-OKLLHYPPSA-N	present	NPASS
WJXIFVMRNAVQFU-BGMZQYASSA-N	present	NPASS
ZSJSEKVRNNGVKO-MUBOMVAMSA-N	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia squamosa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences7

eDNA detections2

Countries3

The DNA barcodea real sequence read deposited for this species

ITSJF732983.1 ↗647 bp

ACGT

TCGAAACGTGCTCTGTAGAAGCATGCTGGACGATGTGAGTAATGAGAATGGTTGAAACAGGAGTCGTCGATCGTTGATTCGTCAATGGTG …

Euphorbia squamosa voucher Zarre & Salmaki 39668 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Euphorbia squamosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Davlianidze, M. T. 1984. Investigatio cytogeographics speciorum nonnullarum altimontanarum e Caucaso. Not. Syst. Georg. Inst. Bot. Thbilissi. 40: 56–66.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type466 records

Wild obs. + sensor349

Museum / vouchered117

Range

Area of Occupancy AOO1 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 199≤1 km 40≤10 km 14>10 km 15

268 georeferenced · 81 without coordinates

Open the mapobservation + sensor349

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 2≤1 km 7≤10 km 40>10 km 3

52 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence117

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	87
Wlocation not on record	12
Berlin, DE	4
BClocation not on record	2
Durham, US	2
LDlocation not on record	2
Saint Louis, US	1
Kew, GB	1

8 institutions · 111 of 117 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Euphorbia squamosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-2.20 °C -2.20–-2.20

Seasonal swing summer↔winter43.2 °C

Max temp (day)1.70 °C

Min temp (night)-7.00 °C

Precipitation36.6 mm/mo

Air humidity60.4 %

Moisture balance-10.1 mm/mo

Vapour deficit364 Pa

Wind speed2.10 m/s

Cloud cover58.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)