Euphorbia serpens
Kunth · speciesAt a glance
Occurrence records9 700
Data sources11
Biological traits59
DNA specimens26
eDNA detections22
Sources11 archives
Databases and archives Euphorbia serpens's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 700 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Tree of SexTree of Sex Consortiumgenome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources59 traits
Occurrence & distributionGBIF9 700 records
Environmental DNA2 datasets · 9 countries22 detections
DNA & barcodingBOLD · NCBI26 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2n = 22
01Narrative
Euphorbia serpens é uma espécie de planta com flor pertencente à família Euphorbiaceae. A autoridade científica da espécie é Kunth, tendo sido publicada em Flora of the Southeastern United States 709, 1333. 1903.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsGIFTTRY
Size & morphology21
Fruit length1.3 mm
⚠ sources differ — AusTraits: 1.3 mm · GIFT: 1.65 mm
Fruit length max1.8 mm
Fruit length min1 mm
Fruit width1.5 mm
⚠ sources differ — AusTraits: 1.5 mm · GIFT: 1.75 mm
Fruit width max2 mm
Fruit width min1.4 mm
Leaf length4.5 mm
⚠ sources differ — AusTraits: 4.5 mm · GIFT: 3.5 mm
Leaf length max60 mm
Leaf length min2 mm
Leaf width4 mm
⚠ sources differ — AusTraits: 4 mm · GIFT: 2.25 mm
Leaf width max40 mm
Leaf width min1.5 mm
Petiole length0.045 cm
Plant height max0.25 m
Plant height min0.051 m
Seed length0.95 mm
Seed length max1.2 mm
Seed length min1 mm
Seed mass0.538 mg
⚠ sources differ — TRY: 0.538 mg · GIFT: 0.2 mg
Seed width max0.7 mm
Seed width min0.5 mm
Life cycle & reproduction14
Deciduousnessdeciduous
Dehiscencedehiscent
Dispersal typeanimal
Flower colourred
Flowering endMay
Flowering startDec
Flowering timennnnnnnnynnn
Life formannual
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual perennial · GIFT: annual
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 550 m
Elevation mean362 m
Elevation min0 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTÁrea Antrópica, Floresta Estacional Semidecidual
Leaf compoundnesssimple
Leaf formorbicular
Leaf shapeoblong orbicular ovate
Mycorrhiza type0.00000000000439
Woodinessnon-woody
Physiology & chemistry4
Leaf c430 mg/g
Leaf n20.09 mg/g
Photosynthetic pathwayC4
Specific leaf area (SLA)18.32 mm²/mg
Other traits4
Diaspore typeseed
Seeds per fruit101-1000
Shoot length max25 cm
Shoot orientationprostrate
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia serpens has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes6
GenBank sequences10
eDNA detections22
Countries9
The DNA barcodea real sequence read deposited for this species
CGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGTGTCACTCAATCGTCGCCCAACCCTCCTCCATTTCTAAATGAGAGTGCGAGT …
Euphorbia serpens voucher CCDB-23363-E03 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL3★rbcLa★trnL-F★ITS6★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Euphorbia serpens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Chromosome records22–242n range22median22mode9records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 225×GoaT · Tree of Sex Database · CCDB · iber-fl · CCDB · ipcn-api-dl +1
GoaT · Tree of Sex Database — ↗
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 46-47. Ceballos, A. & J. Fernndez Casas.Anales Jard. Bot. Madrid36: 399(1980).
CCDB · ipcn-api-dl — Benedi, C. & J. J. Orell. 1992. Mediterranean chromosome number reports 2 (64--69). Fl. Medit. 2: 239–243.
CCDB · ipcn-api-dl — Ceballos Jimenez, A. & J. F. Casas. 1980. N'imeros cromosomaticos de plantas occidentales, 46-47. Anales Jard. Bot. Madrid 36: 399–400.
CCDB · CromoCat 2015 — Ceballos, A. & Fernández Casas, J. (1980). Números cromosomáticos de plantas occidentales, 46-47. Anales Jard. Bot. Madrid 36: 399.
2n 244×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015 +1
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XI. Euphorbiaceae Queirs, M.Bol. Soc. Brot. ser. 249: 143-161(1975).
CCDB · ipcn-api-dl — Queiros, M. 1975a. Contribuicao para o conhecimento citotaxonomico das Spermatophyta de Portugal. XI. Euphorbiaceae. Bol. Soc. Brot., sér. 2 49: 143–161.
CCDB · CromoCat 2015 — Queirós, M. (1975b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XI. Euphorbiaceae. Bol. Soc. Brot. 49: 143-161.
TreeOfSex · plant — Goldblatt1979 ↗
n 64×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015 +1
CCDB · ipcn-api-dl — Subils, R. 1977. Las especies de Euphorbia de la Republica Argentina. Kurtziana 10: 83–248.
CCDB · book-ipcn75-78 — Subils 1977
CCDB · CromoCat 2015 — Subils, R. (1977). Las especies de Euphorbia de la Republica Argentina Kurtziana 10: 83–248
TreeOfSex · plant — Goldblatt1979 ↗
n 82×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Subils, R. 1977. Las especies de Euphorbia de la Republica Argentina. Kurtziana 10: 83–248.
CCDB · book-ipcn75-78 — Subils 1977
n 112×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
08Occurrence & distribution
Record type9 700 records
Wild obs. + sensor7 453
Museum / vouchered2 137
Other110
Origin
Native64
Introduced22
Range
Area of Occupancy AOO24 560 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy78% within 1 km
≤100 m 3 514≤1 km 448≤10 km 850>10 km 270
5 082 georeferenced · 2 371 without coordinates
Open the mapobservation + sensor7 453
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 170≤1 km 168≤10 km 333>10 km 93
764 georeferenced · 1 373 without coordinates
Open the institutions mapphysical evidence2 137
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions114 of 199 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Chicago, US | 274 |
| Wuzhou, CN | 228 |
| Bronx, US | 205 |
| Saint Louis, US | 93 |
| Barcelona, ES | 85 |
| BDBClocation not on record | 69 |
| Emporia, US | 66 |
| San Diego, US | 63 |
| Pretoria, ZA | 59 |
| Riverside, US | 51 |
| Philadelphia, US | 44 |
| Ann Arbor, US | 33 |
| Durango, MX | 29 |
| Claremont, US | 26 |
| TAIElocation not on record | 22 |
| Texas Lutheran Universitylocation not on record | 21 |
| Santa Barbara, US | 21 |
| Fort Worth, US | 20 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 18 |
| Adelaide, AU | 17 |
| Mexico City, MX | 17 |
| València, ES | 17 |
| Chadron, US | 17 |
| Culiacán, MX | 17 |
| Tampa, US | 16 |
| BClocation not on record | 14 |
| LDlocation not on record | 13 |
| San Luis Obispo, US | 13 |
| Paris, FR | 13 |
| MeiseBGlocation not on record | 13 |
| ASUlocation not on record | 12 |
| Austin, US | 12 |
| Madison, US | 11 |
| Chongqing Museumlocation not on record | 10 |
| Lubbock, US | 10 |
| University of Stellenboschlocation not on record | 10 |
| UFMSlocation not on record | 9 |
| Provincia di Livornolocation not on record | 9 |
| EL PASO, US | 9 |
| Kew, GB | 8 |
| Brisbane, AU | 8 |
| SLU Artdatabankenlocation not on record | 8 |
| Pomona Collegelocation not on record | 7 |
| BAYLUlocation not on record | 7 |
| CICYTEXlocation not on record | 7 |
| Irvine, US | 7 |
| La Paz, MX | 7 |
| Museo Entomologico de Leonlocation not on record | 7 |
| UChlocation not on record | 7 |
| Santa Cruz de la Sierra, BO | 6 |
| Spearfish, US | 6 |
| Córdoba, AR | 6 |
| Vancouver, CA | 5 |
| ISAlocation not on record | 5 |
| Frankfurt am Main | 5 |
| Pittsburg, US | 5 |
| Davis, US | 5 |
| Jackson, US | 5 |
| CASlocation not on record | 5 |
| MAlocation not on record | 5 |
| Altos de Pipe, VE | 5 |
| Oskarshamn, SE | 5 |
| Cape Town, ZA | 5 |
| Little Rock, US | 5 |
| Mexico City, MX | 5 |
| Bloomington, US | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Moscow State Universitylocation not on record | 5 |
| Wlocation not on record | 4 |
| San Isidro, AR | 4 |
| Juriquilla, MX | 4 |
| Valparaiso, CL | 4 |
| Paleontological Collectionlocation not on record | 4 |
| Vitoria, ES | 4 |
| Bozeman, US | 4 |
| Missoula, US | 3 |
| CJBGlocation not on record | 3 |
| Instituto do Meio Ambientelocation not on record | 3 |
| BRNUlocation not on record | 3 |
| Burlington, US | 3 |
| Chapingo, MX | 3 |
| Pondicherry, IN | 3 |
| Criciúma, BR | 3 |
| USP-IBlocation not on record | 3 |
| Laboratorio de Ictiologialocation not on record | 3 |
| Tuscaloosa, US | 3 |
| Mérida, MX | 3 |
| Hermosillo, MX | 3 |
| UNESClocation not on record | 3 |
| GJOlocation not on record | 3 |
| Chaguaramas, TT | 3 |
| BISHlocation not on record | 2 |
| Brasília, BR | 2 |
| Phoenix, US | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Zürich, CH | 2 |
| IPA/SPlocation not on record | 2 |
| Salamanca, ES | 2 |
| Albuquerque, US | 2 |
| University of New Hampshirelocation not on record | 2 |
| Flagstaff, US | 2 |
| San Sebastián, ES | 2 |
| Brussel, BE | 2 |
| Toronto, CA | 2 |
| Shanghai, CN | 2 |
| Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record | 2 |
| Cenargenlocation not on record | 2 |
| Lausanne, CH | 2 |
| Granada, ES | 2 |
| Mount Annan, AU | 2 |
| Brasília, BR | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| Catalina Island Conservancylocation not on record | 2 |
| UEMlocation not on record | 2 |
| Boise, US | 2 |
| Maringá, BR | 2 |
| Castelar, AR | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| Fayetteville, US | 2 |
| GB | 2 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 2 |
| Feira de Santana, BR | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Zürich, CH | 2 |
| Texas Lutheran Universitylocation not on record | 2 |
| Mississippi State, US | 2 |
| Blumenau, BR | 2 |
| Auckland, NZ | 1 |
| Wellington, NZ | 1 |
| Pullman, US | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| Mlocation not on record | 1 |
| Durban, ZA | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Pamplona, ES | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Campo Mourão, BR | 1 |
| Honolulu, US | 1 |
| BIO-UNIPIlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| UFBAlocation not on record | 1 |
| Denver, US | 1 |
| The University of Arizonalocation not on record | 1 |
| Montréal, CA | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| UFPIlocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Moscow, US | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Salzburg, AT | 1 |
| LfUlocation not on record | 1 |
| Cochabamba, BO | 1 |
| Santiago, CL | 1 |
| MEXUlocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Xiamen, CN | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Armidale, AU | 1 |
| Waverly, US | 1 |
| Dekalb, US | 1 |
| Badajoz, ES | 1 |
| sonstHerblocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| UNIVASFlocation not on record | 1 |
| Teresina, BR | 1 |
| St. Augustine, TT | 1 |
| James Cook Townsvillelocation not on record | 1 |
| Sharjah Seed Bank & Herbariumlocation not on record | 1 |
| UIBlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Guasave, MX | 1 |
| INTAlocation not on record | 1 |
| Berea Collegelocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| St. Paul, US | 1 |
| Palmerston, AU | 1 |
| Calabar, NG | 1 |
| Columbia, US | 1 |
| San Angelo, US | 1 |
| UnBlocation not on record | 1 |
| Londrina, BR | 1 |
| PUC-RSlocation not on record | 1 |
| URCAlocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| UFSClocation not on record | 1 |
| National Herbarium of São Tomé and Principelocation not on record | 1 |
| South Kensington, GB | 1 |
| Denton, US | 1 |
| BG-NMNHSlocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Whitehorse, CA | 1 |
199 institutions · 2 079 of 2 137 vouchered records shown · 56 without an institution code
09Environmental DNA22 detections
Where the DNA of Euphorbia serpens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys2
Countries9
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map9 countries0
bare clay till of butte 150ft over river lev…on and atop steep bare butte of proglacial s…Floodplaindry bare ended slope of caly till, S-facing,…landscaped parking lot border in loose rich …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.1 °C 15.5–26.6
Seasonal swing summer↔winter12.4 °C
Max temp (day)26.5 °C 19.4–31.9
Min temp (night)16.1 °C 11.9–23.2
Precipitation79.8 mm/mo 8.90–164
Air humidity59.1 % 54.4–62.8
Moisture balance-71.7 mm/mo -135–76.9
Vapour deficit1,094 Pa 651–1,458
Wind speed3.30 m/s 2.40–4.90
Cloud cover32.2 % 13.5–46.5
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.