Euphorbia pachypodioides

Boiteau · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records15

Data sources9

Biological traits12

DNA specimens5

eDNA detections5

Sources9 archives

Databases and archives Euphorbia pachypodioides's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Euphorbia pachypodioides is a species of plant in the family Euphorbiaceae. It is endemic to Madagascar. Its natural habitat is rocky areas. It is threatened by habitat loss. It also has the binomial synonym Euphorbia antankara (Leandri, 1946). This small plant is available from several sources for enthusiasts. It is attractive, but slow growing.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formsemisucculent subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Succulenceyes

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia pachypodioides has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences6

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ534754.1 ↗216 bpMadagascar

ACGT

AATGTTGCTCCAACCCCCTCCCATTGGAAGGGCTGTGTGGGGCGGATGTTGGCCTCCCGTGTGCACATTGCCCGTGGTTGGCCCAAATGT …

Euphorbia pachypodioides ITS2, specimen voucher Rauh 72072 (HEID)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type15 records

Wild obs. + sensor7

Museum / vouchered8

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 7

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	3
Plocation not on record	1
Kew, GB	1
Saint Louis, US	1

4 institutions · 6 of 8 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Euphorbia pachypodioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 18.4–18.4

Seasonal swing summer↔winter5.30 °C

Max temp (day)23.4 °C

Min temp (night)12.9 °C

Precipitation163 mm/mo

Air humidity58.7 %

Moisture balance34.0 mm/mo

Vapour deficit870 Pa

Wind speed2.80 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)