Euphorbia leuconeura

Boiss. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records71

Data sources11

Biological traits12

DNA specimens10

eDNA detections10

Sources11 archives

Databases and archives Euphorbia leuconeura's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility71 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS · NPASS23 compounds

Occurrence & distributionGBIF71 records

Environmental DNA1 datasets · 0 countries10 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Euphorbia leuconeura is a species of flowering plant in the family Euphorbiaceae. Its common name is Madagascar jewel. It is endemic to Madagascar where its natural habitat is forest undergrowth in rocky areas. It can grow to a height of 1.8 m, as a branching small tree, and propagates by shooting its seeds several feet into the air. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formsemisucculent subshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Succulenceyes

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition23 compounds

Compounds documented for Euphorbia leuconeura across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols6

Ingenane diterpenoids $ Tetracyclic diterpenoids3

Friedelane triterpenoids3

Furofuranoid lignans1

Agarofuran sesquiterpenoids $ Pyridine alkaloids $ Terpenoid alkaloids1

Documented compounds23 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Syringaresinol	present	NPASS
(2R)-4-[(13S)-13-[(2S,5S)-5-[(2S,5S)-5-[(1R,5S)-1,5-dihydroxyundecyl]oxolan-2-yl]oxolan-2-yl]-13-hydroxytridecyl]-2-methyl-2H-furan-5-one	present	NPASS
3-[(2R,3S,4R,5S,6S)-3-[(2R,3S,4S,5R,6R)-3,5-dihydroxy-6-methyl-4-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-[[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-2-(3,4-dihydroxyphenyl)-5,7-dihydroxychromen-4-one	present	NPASS
3-[(2R,3S,4R,5S,6S)-3-[(2R,3S,4S,5R,6R)-3,5-dihydroxy-6-methyl-4-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-[[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-5,7-dihydroxy-2-(4-hydroxyphenyl)chromen-4-one	present	NPASS
3-[(2R,3S,4R,5S,6S)-3-[(2S,3R,4R,5S,6S)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-[[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-5,7-dihydroxy-2-(4-hydroxyphenyl)chromen-4-one	present	NPASS
[(1S,3R,13S,14S,17S,18R,19R,20R,21S,22S,23R,24R,25S)-18,19,21,24-tetraacetyloxy-20-(acetyloxymethyl)-25-hydroxy-3,13,14,25-tetramethyl-6,15-dioxo-2,5,16-trioxa-11-azapentacyclo[15.7.1.01,20.03,23.07,12]pentacosa-7(12),8,10-trien-22-yl] benzoate	present	NPASS
[(1S,4S,5R,6R,9S,10R,12R,14R)-7-(acetyloxymethyl)-4,5-dihydroxy-3,11,11,14-tetramethyl-15-oxo-6-tetracyclo[7.5.1.01,5.010,12]pentadeca-2,7-dienyl] 2-[(2-aminobenzoyl)amino]benzoate	present	LOTUS
[(1S,4S,5S,6R,9S,10R,12R,14R)-7-(acetyloxymethyl)-5,6-dihydroxy-3,11,11,14-tetramethyl-15-oxo-4-tetracyclo[7.5.1.01,5.010,12]pentadeca-2,7-dienyl] 2-[(2-aminobenzoyl)amino]benzoate	present	LOTUS
[(1S,4S,5S,6R,9S,10R,12R,14R)-7-(acetyloxymethyl)-5,6-dihydroxy-3,11,11,14-tetramethyl-15-oxo-4-tetracyclo[7.5.1.01,5.010,12]pentadeca-2,7-dienyl] 2-[(2-benzamido-3-hydroxybenzoyl)amino]benzoate	present	LOTUS
Alcesefoliside	present	NPASS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia leuconeura has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes3

GenBank sequences10

eDNA detections10

The DNA barcodea real sequence read deposited for this species

ITSJQ952349.1 ↗700 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCAAAACCTGCCTAGCAGAATGACCTGTGAACATGTTCATAAATTGAGGGGTTGCTGC …

Euphorbia leuconeura voucher XA130a internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type71 records

Wild obs. + sensor12

Museum / vouchered58

Cultivated / captive1

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤1 km 1>10 km 11

12 georeferenced

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 2≤1 km 1≤10 km 2

5 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence58

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	11
Paris, FR	7
Plocation not on record	6
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	6
Kew, GB	5
Glocation not on record	4
Bangkok, TH	4
CJBGlocation not on record	3
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	2
University of Stellenboschlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Chongqing Museumlocation not on record	1
Burlington, US	1
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	1
GB	1
WAGlocation not on record	1
Gump Stationlocation not on record	1

17 institutions · 56 of 58 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Euphorbia leuconeura was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)