Euphorbia helioscopia

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records270 185

Data sources15

Biological traits73

DNA specimens58

eDNA detections35

Sources15 archives

Databases and archives Euphorbia helioscopia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility270 184 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page8 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources73 traits

Chemical compositionLOTUS · NPASS205 compounds

Occurrence & distributionGBIF · PBDB270 185 records

Environmental DNA1 datasets · 13 countries35 detections

DNA & barcodingBOLD · NCBI58 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex1.1 Gbp

Deep timePBDB1 fossils

01Narrative

L'Euphorbe réveille-matin ou Petite Éclaire ou encore Herbe aux verrues, est une espèce de plantes herbacées de la famille des Euphorbiacées. Elle est très commune en France. Helioscopia "qui regarde le soleil", dérivé du grec, fait allusion à l'ombelle qui se déploie tôt le matin, face au soleil, d'où, aussi, le nom vernaculaire de réveille-matin.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTAusTraitsLEDATRYWCVP

Size & morphology29

Fruit length2 mm

⚠ sources differ — AusTraits: 2 mm · GIFT: 2.75 mm

Fruit length max3 mm

Fruit length min2.5 mm

Fruit width3 mm

⚠ sources differ — AusTraits: 3 mm · GIFT: 3.75 mm

Fruit width max4.5 mm

Fruit width min3 mm

Inflorescence length max0.2 cm

Inflorescence length min0.1 cm

Leaf length15 mm

⚠ sources differ — AusTraits: 15 mm · GIFT: 22.5 mm

Leaf length max40 mm

Leaf length min4 mm

Leaf mass6.29 mg

Leaf size316 mm²

⚠ sources differ — TRY: 316 mm² · LEDA: 228 mm² · GIFT: 457 mm²

Leaf width17.5 mm

⚠ sources differ — AusTraits: 17.5 mm · GIFT: 10 mm

Leaf width max15 mm

Leaf width min2 mm

Plant height0.25 m

⚠ sources differ — GIFT: 0.25 m · AusTraits: 0.5 m · LEDA: 0.2 m · TRY: 0.245 m

Plant height generative0.2 m

Plant height max0.5 m

Plant height min0.05 m

Seed length2.11 mm

⚠ sources differ — TRY: 2.11 mm · AusTraits: 1.75 mm · GIFT: 2 mm

Seed length max2.3 mm

Seed length min1.5 mm

Seed mass2.34 mg

⚠ sources differ — TRY: 2.34 mg · LEDA: 2.76 mg · GIFT: 2.3 mg

Seed mass max2.8 mg

Seed mass min1.13 mg

Seed width1.7 mm

Seed width max1.7 mm

Seed width min1.2 mm

Life cycle & reproduction16

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dehiscencedehiscent

Dispersal typehuman

⚠ sources differ — LEDA: agochor · GIFT: unspecialized

Flower colouryellow

Flowering endAug

Flowering startApr

Life formannual or biennial

Life spanannual

Lifespan years1 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formtherophyte

⚠ sources differ — LEDA: Therophyte · GIFT: hemicryptophyte

Reproduction asexualabsent

Seed number625

Self fertilizationabsent

Sex typemonoecious

⚠ sources differ — AusTraits: monoecious · GIFT: bisexual

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment14

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 890 m

Elevation min0 m

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: forb-annual

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf formobovate

Leaf shapeobovate spathulate

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry8

Leaf c480 mg/g

Leaf dry-matter content (LDMC)175 mg/g

⚠ sources differ — TRY: 175 mg/g · LEDA: 201 mg/g

Leaf n29.24 mg/g

Leaf p1.4 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Seed longevity index0.5

Specific leaf area (SLA)34.59 mm²/mg

⚠ sources differ — TRY: 34.59 mm²/mg · LEDA: 35.65 mm²/mg · GIFT: 33.83 mm²/mg

Other traits4

Diaspore typeseed

Inflorescencecyme

Seeds per fruit11-100

Shoot orientationerect

03Chemical composition205 compounds

Compounds documented for Euphorbia helioscopia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Jatrophane diterpenoids88

Gallotannins37

Lathyrane diterpenoids13

Furanoabietane diterpenoids8

Chalcones7

Documented compounds205 total

Compound	Amount	Source
(+)-Dehydrovomifoliol	present	LOTUS
(-)-alpha-Curcumene	present	NPASS
(1-Acetyloxy-13-hydroxy-3,6,6,10,14-pentamethyl-2-oxo-9-tricyclo[10.3.0.05,7]pentadeca-3,10-dienyl) octa-2,4-dienoate	present	LOTUS
(1aS,4aR,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol	present	NPASS
(1R,2R,4S)-1-[(3R)-3,4-dihydroxybut-1-enyl]-2,6,6-trimethylcyclohexane-1,2,4-triol	present	LOTUS
(1S,19R,20R,35R,37S)-6,7,8,11,12,13,24,25,29,29,30-undecahydroxy-37-methoxy-2,17,21,34,36,38-hexaoxaoctacyclo[17.16.1.120,35.126,30.04,9.010,15.022,27.028,33]octatriaconta-4,6,8,10,12,14,22(27),23,25,32-decaene-3,16,31-trione	present	LOTUS
(1S,4R,6R,10R)-4,12,12-trimethyl-9-methylidene-5-oxatricyclo[8.2.0.04,6]dodecane	present	NPASS
(1S,4S,5R,9S,10R,13R)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecan-5-ol	present	NPASS
(1S,4S,5S,9S,10R,13R)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecan-5-ol	present	NPASS
(2,3,14,15,16,19,20,21,35,36-Decahydroxy-6,11,24,32-tetraoxo-7,10,25,28,31,40-hexaoxaoctacyclo[35.2.1.05,39.08,27.09,30.012,17.018,23.033,38]tetraconta-1(39),2,4,12,14,16,18,20,22,33,35,37-dodecaen-29-yl) 3,4,5-trihydroxybenzoate	present	LOTUS

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia helioscopia has left across the world's sequence archives.

At a glance

DNA specimens58

Marker genes6

GenBank sequences10

eDNA detections35

Countries14

The DNA barcodea real sequence read deposited for this species

ITSPZ036610.1 ↗699 bpAlbania · 2021

ACGT

TCGAAACCTGCCTAGCAGAACGACCCGTGAACATGTTTGTAAATCGAGGGGTCGACGTAGGATTTGTCCATCGTGGATCCCTCATTGGGG …

Euphorbia helioscopia isolate Ehelioscopia_16600 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK3rbcL2rbcLaITS5ITS1ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Euphorbia helioscopia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 075 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Euphorbia helioscopia1.08 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome records12–422n range42median42mode52records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 4251×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Tree of Sex Database · CCDB · ita-fl +18

GoaT · DTOL Flowering Plants Estimates Kew

GoaT · Tree of Sex Database — ↗

CCDB · ita-fl — PAVONE P., TERRASI M.C., ZIZZA A. - 1981. Chromosome number reports LXXII.. Taxon , 30(3): 695-696.

CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.

CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.

CCDB · iapt — IAPT/IOPB Chromosome Data 8

CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · iber-fl — Contribucin al estudio cariolgico del gnero Euphorbia L., subgn. Esula Pers. Juan, R. & J. Pastor.Bol. Soc. Brot. ser. 266: 41-54(1993).

CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XI. Euphorbiaceae Queirs, M.Bol. Soc. Brot. ser. 249: 143-161(1975).

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 225-239. Garca, I. & B. Valds.Lagascalia10(2): 241-247(1981).

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3103

CCDB · fl-europaea — Lb'vkvist, 1963

CCDB · poland — Bauer Z. 1971. Karyological studies iu the genus Euphorbia L. II. Acta Biol. Cracov. Ser. Bot. 14, 159-178.

CCDB · mediterranean

CCDB · ipcn-api-dl — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal. 1997. Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365–368.

CCDB · ipcn-api-dl — Fiorini, G. & M. Raffaelli. 1996. Mediterranean chromosome number reports 6 (705--715). Fl. Medit. 6: 278–288.

CCDB · ipcn-api-dl — Wang, Y. h., J. s. Ma & Q. r. Liu. 1999. Karyotypes of eight species of Euphorbia L. (Euphorbiaceae) from China. Acta Phytotax. Sin. 37(4): 394–402.

CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.

CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.

CCDB · ipcn-api-dl — Pavone, P., C. M. Terrasi & A. Zizza. 1981. In Chromosome number reports LXXII. Taxon 30: 695–696.

CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.

CCDB · ipcn-api-dl — Garcia, I. & B. VALDES. 1981. In Numeros cromosomicos para la flora EspaPiola. 182-256. Lagascalia 10: 225–256.

CCDB · ipcn-api-dl — Chung, G. Y., B. u. Oh, K. R. Park, J. H. Kim, M. S. Kim, G. H. Nam & C. G. Jang. 2003. Cytotaxonomic study of Korean Euphorbia L. (Euphorbiaceae). Korean J. Pl. Taxon. 33: 279–293.

CCDB · ipcn-api-dl — Queiros, M. 1975a. Contribuicao para o conhecimento citotaxonomico das Spermatophyta de Portugal. XI. Euphorbiaceae. Bol. Soc. Brot., sér. 2 49: 143–161.

CCDB · ipcn-api-dl — HURUSAWA, I. & S. SHIMOYAMA. 1976. Die Mannigfaltigkeit der Chromosomenzahl bei der Gattung Euphorbia. Beitr. Biol. Pflanzen 52: 255–266.

CCDB · ipcn-api-dl — Murin, A. 1974. In Index of chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.

CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.

CCDB · book-ipcn67-71 — BAUER, z. 1971. Karyological studies in the genus Euphorbia L. II. Acta Biol. Cracov., Ser. Bot. 14: 159-178.

CCDB · book-ipcn75-78 — Hurusawa & Shimoyama 1976

CCDB · book-ipcn75-78 — Queiros 1975a

CCDB · book-northern-plants — L. & L. 1944 b.

CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.

CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.

CCDB · book-indian_vol1 — Harrison, H.H. (Tischler, G. 1931); Tischler, G. 1934, 1937 ; Rohweder, H. 1937 ; Bhalla, V. 1941a ; Llive, A. & LOve, D. 1942a, 1944b ; Perry, B.A. 1943 ; Gadella, T.W.J. & Kliphuis, E. 1968a ; Bauer, Z. 1971 ; Gill, B.S., Chawla, A. & Kanwal, R. 1971, 1973; Choda, S.P. & Mehra, P.N. 1972 ; Sarkar, A.K., Datta, N. et al. 1976; Mehra, P.N. & Choda, S.P. 1978 ; Krishnappa, D.G. & Reshme. R.V. 1980

CCDB · eflora

CCDB · book-atlas-flowering-plants — Eur., Medit.

CCDB · CromoCat 2015 — Bauer, Z. (1971). Karyological studies on the genus Euphorbia L. II. Acta Biol. Cracov., Ser. Bot. 14: 159-178.

CCDB · CromoCat 2015 — Bhalla, V. (1942). Life-history of Euphorbia helioscopia Linn. Proc. Indian Sci. Congr. Assoc. 28: 161-162.

CCDB · CromoCat 2015 — Fiorini, G. & Raffaelli, M. (1996). Mediterranean chromosome number reports-6. Fl. Medit. 6: 278-288.

+11 more references

2n 121×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Nemec, B. 1910

n 2116×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +4

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 225-239. Garca, I. & B. Valds.Lagascalia10(2): 241-247(1981).

CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Pavone, P., C. M. Terrasi & A. Zizza. 1981. In Chromosome number reports LXXII. Taxon 30: 695–696.

CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.

CCDB · ipcn-api-dl — Mehra, P. N. & S. P. CHODA. 1978. Cyto-taxonomical studies in the genus Euphorbia L. Cytologia 43: 217–235.

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA, R. Mallick & U. Chatterjee. 1976a. In IOPB chromosome number reports LIV. Taxon 25: 631–649.

CCDB · book-ipcn72 — CHODA, S.P., & P.N. MEHRA. 1972. Cytological studies in some Euphorbiaceae. Curr. Sci. (Bangalore) 41: 76.

CCDB · book-ipcn75-78 — Kaul et al. 1976b

CCDB · book-ipcn75-78 — Mehra & Chode 1978

CCDB · book-ipcn75-78 — Sarkar et al. l 976a

CCDB · book-ipcn73-74 — GILL, B.S., A. CHAWLA, & R. KANWAL. North-West Indian Euphorbiaceae. Cytologia 38: 393-401. I I

CCDB · CromoCat 2015 — García, I. & Valdés, B. (1981). Números cromosómicos para la flora española, 225-239. Lagascalia 10(2): 241-247

CCDB · CromoCat 2015 — Krishnappa, D. G. & Reshme, R. V. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 536-537.

CCDB · CromoCat 2015 — Sarkar, A. K., N. Datta, R. Mallick & U. Chatterjee. (1976a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIV]. Taxon 25(5/6): 648-649.

CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time11.6–3.6 Ma

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

Fossil range11.6–3.6 Ma Miocene, Pliocene

Dated fossil finds1

StatusNot recorded since 3.6 Ma

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Euphorbia helioscopia. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.

fossil range (PBDB)each dot = one dated find

How it livedPBDB

Dietphotoautotroph

08Occurrence & distribution

Record type270 185 records

Wild obs. + sensor258 573

Museum / vouchered10 968

Cultivated / captive19

Fossil1

Other624

Origin

Native3 166

Introduced8 131

Range

Area of Occupancy AOO437 964 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 55 961≤1 km 35 416≤10 km 119 964>10 km 2 207

213 548 georeferenced · 45 025 without coordinates

Open the mapobservation + sensor258 573

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 387≤1 km 2 032≤10 km 3 179>10 km 616

6 214 georeferenced · 4 754 without coordinates

Open the institutions mapphysical evidence10 968

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 13

15 georeferenced · 4 without coordinates

Open the mapnot free-living19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions188 of 335 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	2 927
Berlin, DE	552
Helsinki, FI	437
BFLlocation not on record	429
LDlocation not on record	358
Olocation not on record	269
BRNUlocation not on record	196
Moscow State Universitylocation not on record	157
Québec, CA	148
Turku, FI	144
Odawara, JP	126
MeiseBGlocation not on record	124
Beijing, CN	118
Salzburg, AT	118
Trondheim, NO	108
Uniwersytet Warszawskilocation not on record	104
Oskarshamn, SE	101
Paris, FR	92
SLU Artdatabankenlocation not on record	80
Bergen, NO	75
Yangling, CN	73
Barcelona, ES	70
Nanjing, CN	68
Oulu, FI	65
Görlitz, DE	64
Adam Mickiewicz University in Poznańlocation not on record	60
Philadelphia, US	58
GMBAlocation not on record	57
Chicago, US	57
BDBClocation not on record	55
València, ES	54
Nagano City, JP	52
KMNlocation not on record	50
NSMKlocation not on record	50
Chengdu, CN	48
South Kensington, GB	48
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	48
College of the Atlantic, Museumlocation not on record	47
Mount Annan, AU	46
Provincia di Livornolocation not on record	45
Córdoba, ES	43
CICYTEXlocation not on record	41
Tartu, EE	39
MAlocation not on record	38
TUR-Alocation not on record	38
Adelaide, AU	36
Sanda, JP	35
BClocation not on record	33
Kunming, CN	33
Karlsruhe, DE	33
Auckland, NZ	31
Hobart, AU	31
Wlocation not on record	30
ISAlocation not on record	30
Chongqing Museumlocation not on record	29
Pretoria, ZA	29
Tallinn, EE	29
Chiba, JP	28
Montréal, CA	27
Xinxiang, CN	27
Wuhan, CN	27
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	26
Museo Entomologico de Leonlocation not on record	26
Université Lavallocation not on record	25
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	25
UGentlocation not on record	25
Vitoria, ES	24
Uppsala, SE	24
Christchurch, NZ	24
GJOlocation not on record	24
Guangzhou, CN	23
Lanzhou, CN	23
Philadelphia, US	23
Acadia Universitylocation not on record	22
Ann Arbor, US	22
Tomioka, JP	21
Badajoz, ES	21
Tsukuba, JP	21
Nagatoro-machi, Chichibu-gun, JP	20
San Sebastián, ES	20
Bern, CH	19
Xining, CN	19
Mlocation not on record	19
Institut und Museum fuer Geologie und Palaeontologielocation not on record	18
Burlington, US	18
Shinshu Universitylocation not on record	18
Wellington, NZ	18
TROMlocation not on record	18
Jyväskylä, FI	17
Kew, GB	17
Bando, JP	16
San Jose State University, Museum of Birds and Mammalslocation not on record	16
Frankfurt am Main	16
Saint Louis, US	16
Salamanca, ES	16
Canberra, AU	16
Zürich, CH	16
Brisbane, AU	16
Sagamihara, JP	16
Tokushima, JP	15
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	14
Natural History Museum Rotterdamlocation not on record	14
Zürich, CH	14
Chengdu, CN	13
Cape Town, ZA	13
KURAlocation not on record	13
Kensington, AU	13
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	12
Porvoo, FI	12
WNNUlocation not on record	12
Madrid, ES	12
St. Paul, US	12
CJBGlocation not on record	12
Kagoshima, JP	12
UIBlocation not on record	11
College Park, US	11
CASlocation not on record	11
Fukushima Universitylocation not on record	11
UChlocation not on record	11
Universidad del Pais Vasco (UPV/EHU)location not on record	10
Entomological Society of Latvialocation not on record	10
Riverside, US	10
Kochi, JP	10
Fort Worth, US	9
Córdoba, AR	9
Sevilla, ES	9
Williamsburg, US	9
Dover, US	9
Toronto, CA	9
Parthenon Tama History Museumlocation not on record	9
Madison, US	9
Bronx, US	9
Uniwersytet Opolskilocation not on record	9
Nishihara, JP	9
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	9
Porrentruy, CH	9
Academy of Sciences of the Republic of Uzbekistanlocation not on record	9
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	9
Taipei, TW	9
Herbarium of the Department of Botany, University of Tokyolocation not on record	8
Canadian Department of Agriculturelocation not on record	8
Corvallis, US	8
Forssa, FI	8
Pullman, US	8
Tampa, US	8
SZUlocation not on record	8
Museo della Bonifica di San Donà di Piavelocation not on record	7
DBF-NHMDlocation not on record	7
Uniwersytet Śląski w Katowicachlocation not on record	7
Alicante, ES	7
Chapel Hill, US	7
Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record	7
Kuopio, FI	7
Dresden, DE	7
Knoxville, US	7
Shanghai, CN	6
Guiyang, CN	6
Changsha, CN	6
Rotorua, NZ	6
Pamplona, ES	6
Frauenfeld, CH	6
Saint John, CA	6
University of New Hampshirelocation not on record	6
河南豫北黄河故道湿地鸟类国家级自然保护区location not on record	6
Valparaiso, CL	6
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	6
盐城国家级珍禽自然保护区location not on record	6
Wuzhou, CN	6
Awka, NG	6
nbflocation not on record	6
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	5
Tilburg, NL	5
Guiyang, CN	5
Central China Normal Universitylocation not on record	5
Museo universitario di Chietilocation not on record	5
Edinburgh, GB	5
PrivatHerblocation not on record	5
Bangkok, TH	5
Nishihara, JP	5
Voronezh State Universitylocation not on record	5
WTUlocation not on record	5
Arcata, US	5
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	4
Fulda, DE	4
Göteborg, SE	4
Bourges, FR	4
Glarus, CH	4
Strecker Museum, Baylor Universitylocation not on record	4
GZUlocation not on record	4
Davis, US	4
Phyletisches Museum Jenalocation not on record	4
Zhejiang Universitylocation not on record	4
Jena Microbial Resource Collectionlocation not on record	4
Chengdu, CN	4
KR	4
Stockholm, SE	4
Vancouver, CA	4
J.F.Oberlin Universitylocation not on record	4
Sendai, JP	3
University of Stellenboschlocation not on record	3
Seoul, KR	3
Claremont, US	3
Logan, US	3
Nijmegen, NL	3
Tromso University Museumlocation not on record	3
San Diego, US	3
National Institute of Biological Resourceslocation not on record	3
Wuhan, CN	3
Hunan Geological Museumlocation not on record	3
Naturalis Biodiversity Centerlocation not on record	3
Norfolk, US	3
Tuscaloosa, US	3
Sion, CH	3
GAlocation not on record	3
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Minia, EG	2
National Marine Biodiversity Institute of Korealocation not on record	2
Portland, US	2
Armidale, AU	2
AUAlocation not on record	2
Durham, US	2
DOI/NPS, Greenbelt Parklocation not on record	2
Macomb, US	2
Bozeman, US	2
Pamplona, ES	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Nanjing, CN	2
Monastir, TN	2
Jiangxi College of Educationlocation not on record	2
BSBIlocation not on record	2
Guilin, CN	2
Banyoles, ES	2
Clemson, US	2
Hamilton, US	2
PRClocation not on record	2
Conservatoire botanique national du Bassin parisienlocation not on record	2
Podgorica, ME	2
Jaén, ES	2
Namur, BE	2
Kawasaki Shi Tama Ku, JP	2
Winterthur, CH	2
Toyama, JP	2
Xiamen, CN	2
University of Tennessee at Chattanoogalocation not on record	2
Denver, US	2
Flagstaff, US	2
Victoria, CA	2
Nanchong, CN	2
NMBU:MINAlocation not on record	2
Beijing Normal Universitylocation not on record	2
Xian, CN	2
National Museum Waleslocation not on record	2
OLAlocation not on record	1
Hazara Universitylocation not on record	1
University of Guelph, OAC Herbariumlocation not on record	1
BAYLUlocation not on record	1
ULBF-AGRlocation not on record	1
Davenport, US	1
Post Graduate College Bannulocation not on record	1
Henry Brockhouse Collectionlocation not on record	1
Museo Achille Folettolocation not on record	1
Santa Barbara, US	1
University of Alberta Museumslocation not on record	1
UoB-IBlocation not on record	1
Granada, ES	1
Zhengzhou, CN	1
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	1
Smithfield, AU	1
Shanxi Institute of Biologylocation not on record	1
Moscow, US	1
Beijing, CN	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
San Isidro, AR	1
Los Angeles, US	1
Taipei, TW	1
H-Schuhwlocation not on record	1
Meguro Parasitological Museumlocation not on record	1
Vanderbilt Universitylocation not on record	1
Guiyang, CN	1
FFPRIlocation not on record	1
SGAV-and-NHMDlocation not on record	1
University of Patraslocation not on record	1
University of British Columbia, Herbariumlocation not on record	1
McGill University, Herbariumlocation not on record	1
Jiujiang Forestry Institutelocation not on record	1
WAGlocation not on record	1
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	1
Brussel, BE	1
JBSlocation not on record	1
Museum Of Natural And Environmental History, Shizuokalocation not on record	1
Kyoto Universitylocation not on record	1
Herbario Universidad de Concepciónlocation not on record	1
SNSNMClocation not on record	1
Montréal, CA	1
Omachi Alpine Museumlocation not on record	1
Fullerton, US	1
Fairfax, US	1
Bruce Peninsula National Parklocation not on record	1
Universidad Nacional de Asunciónlocation not on record	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
FLADlocation not on record	1
KIRMlocation not on record	1
Rovaniemi, FI	1
H-AkrKGlocation not on record	1
Austin, US	1
Durban, ZA	1
Otaru, JP	1
Bloomington, US	1
Dekalb, US	1
Trois-Rivières, CA	1
QVMAGlocation not on record	1
Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record	1
San Luis Obispo, US	1
Gijón, ES	1
Whitehorse, CA	1
University of Genevalocation not on record	1
JGSlocation not on record	1
Shanghai Chenshan Botanical Gardenlocation not on record	1
University of Agriculture, Faisalabadlocation not on record	1
JP	1
Research Collection of B. A. Bennettlocation not on record	1
Beijing Natural History Museumlocation not on record	1
Sant Julià de Lòria, AD	1
KOMlocation not on record	1
Musee National d'histoire Naturelle Luxembourglocation not on record	1
Baroda, IN	1
Royal Botanic Gardens, Kewlocation not on record	1
ZRC-SAZUlocation not on record	1
Rishon Le Zion, IL	1
EL PASO, US	1
Boise, US	1
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
inatura Erlebnis Naturschau GmbHlocation not on record	1
Jinghong, CN	1
Henderson, US	1

335 institutions · 10 201 of 10 968 vouchered records shown · 594 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA35 detections

Where the DNA of Euphorbia helioscopia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries13

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map13 countries0

In limestone fieldscrubland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 8.20–17.9

Seasonal swing summer↔winter15.3 °C

Max temp (day)16.4 °C 11.7–22.2

Min temp (night)9.30 °C 3.80–13.8

Precipitation73.1 mm/mo 50.3–141

Air humidity60.5 % 57.5–63.1

Moisture balance-22.4 mm/mo -67.5–46.9

Vapour deficit690 Pa 415–899

Wind speed3.70 m/s 2.50–6.00

Cloud cover41.4 % 32.6–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources15 archives

Size & morphology29

Life cycle & reproduction16

Diet & foraging2

Habitat & environment14

Physiology & chemistry8

Other traits4

Compound class profile5 classes

Documented compounds205 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

How it livedPBDB

Record type270 185 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions188 of 335 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type270 185 records