Euphorbia haeleeleana

Herbst · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records19

Data sources10

Biological traits26

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Euphorbia haeleeleana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF19 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Euphorbia haeleeleana, the Kauai spurge, is a species of flowering plant in the croton family, Euphorbiaceae, that is endemic to the islands of Kauai and Oahu in Hawaii. Like other Hawaiian spurges it is known as `akoko. It inhabits dry, coastal mesic, and mixed mesic forests from 205 -. Associated plants include ōhia lehua (Metrosideros polymorpha), koa (Acacia koa), lama (Diospyros sandwicensis), kukui (Aleurites moluccanus), aalii (Dodonaea viscosa), wiliwili (Erythrina sandwicensis), hala pepe (Dracaena spp.), ohe kukuluāeo (Reynoldsia sandwicensis), and āulu (Sapindus oahuensis). Kauai Spurge is a small tree, reaching a height of 3 -. It is threatened by habitat loss and disturbance. Feral pigs and goats damage the habitat and non-native plant species take hold there and compete for resources.USFWS. E. haeleeleana Five-year Review. August 2010.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology13

Fruit length max14 mm

Fruit length min11 mm

Fruit width max14 mm

Fruit width min11 mm

Leaf length max150 mm

Leaf length min100 mm

Leaf width max60 mm

Leaf width min40 mm

Plant height max14 m

Plant height min3 m

Seed length max9 mm

Seed length min7 mm

Seed width max5 mm

Life cycle & reproduction5

Dehiscencedehiscent

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formtree

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia haeleeleana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF537514.1 ↗646 bp

ACGT

TCGAAACCTGCCCAGCAGAATGACCCGCGAACATGTTCATAAACCGGGGTGCCGCCGCGGGATTCTTCCAGCGTCGTCCCCCACCACGGG …

Euphorbia haeleeleana internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type19 records

Wild obs. + sensor9

Museum / vouchered10

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 9

9 georeferenced

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Stellenboschlocation not on record	5
Bronx, US	2
Honolulu, US	2
Chicago, US	1

4 institutions · 10 of 10 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Euphorbia haeleeleana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)