Euphorbia decorsei

Drake · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records58

Data sources9

Biological traits9

DNA specimens7

eDNA detections7

Sources9 archives

Databases and archives Euphorbia decorsei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF58 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Euphorbia decorsei is a species of plant in the family Euphorbiaceae. It is endemic to Madagascar and its natural habitat is subtropical or tropical dry forests. However, it is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Epiphyteterrestrial

Growth formtree

Succulenceyes

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia decorsei has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKC019534.1 ↗621 bp

ACGT

TCGAAACCTGCCCAGCAGAACGACCCGTGAACATGTTCAAAAATCGAGGTGTCGTCGCGGGATTCATCCAACGTCGTCACCTCACTAGGG …

Euphorbia decorsei voucher Dorsey, B.L. 161 (MICH) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS5★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type58 records

Museum / vouchered58

Range

Area of Occupancy AOO68 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence58

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	33
Plocation not on record	6
Kew, GB	3
Saint Louis, US	3
Ann Arbor, US	2
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	2
Davis, US	1
UMKClocation not on record	1
University of Stellenboschlocation not on record	1
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	1
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	1

11 institutions · 54 of 58 vouchered records shown · 3 without an institution code

09Environmental DNA7 detections

Where the DNA of Euphorbia decorsei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 18.4–18.4

Seasonal swing summer↔winter5.30 °C

Max temp (day)23.4 °C

Min temp (night)12.9 °C

Precipitation163 mm/mo

Air humidity58.7 %

Moisture balance34.0 mm/mo

Vapour deficit870 Pa

Wind speed2.80 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)