Euphorbia cyparissias

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records434 207

Data sources15

Biological traits51

DNA specimens58

eDNA detections31

Sources15 archives

Databases and archives Euphorbia cyparissias's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility434 207 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources51 traits

Chemical compositionLOTUS · NPASS37 compounds

Occurrence & distributionGBIF434 207 records

Environmental DNA1 datasets · 7 countries31 detections

DNA & barcodingBOLD · NCBI58 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex1.4 Gbp

01Narrative

Euphorbia cyparissias, the cypress spurge, is a species of plant in the genus Euphorbia. It is native to Europe and was introduced to North America in the 1860s as an ornamental plant. Natural habitat types include dunes, pannes, coastal headlands and grasslands. In North America it is commonly found in the dry, gravelly soil of roadsides, pastures, and meadows. Cypress spurge thrives in open, disturbed areas. leaves

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVPAusTraits

Size & morphology15

Leaf length22.5 mm

Leaf length max15 mm

Leaf size52.3 mm²

Leaf width1.75 mm

Plant height0.175 m

⚠ sources differ — GIFT: 0.175 m · LEDA: 0.2 m · TRY: 0.227 m

Plant height generative0.59 m

Plant height max0.5 m

Plant height min0.15 m

Seed length1.98 mm

⚠ sources differ — TRY: 1.98 mm · AusTraits: 1.85 mm · GIFT: 1.6 mm

Seed length max1.6 mm

Seed length min1.6 mm

Seed mass2.09 mg

⚠ sources differ — TRY: 2.09 mg · LEDA: 1.91 mg · GIFT: 1.87 mg

Seed mass max1.91 mg

Seed mass min1.91 mg

Seed width1.4 mm

Life cycle & reproduction13

Deciduousnessevergreen

Dispersal typehuman

Flowering endMay

Flowering startApr

Life formperennial

Life spanperennial

Lifespan years5 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproduction asexualabsent

Seed number377

Self fertilizationabsent

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 400 m

Elevation min1 900 m

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Habitat GIFTforest, old fields, sand

Leaf compoundnesssimple

Leaf shapelinear oblong orbicular reniform rhomboidal

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry7

Leaf c472 mg/g

Leaf dry-matter content (LDMC)338 mg/g

Leaf n27.27 mg/g

Leaf p2.06 mg/g

Photosynthetic pathwayC3

Seed longevity index0

Specific leaf area (SLA)24.06 mm²/mg

⚠ sources differ — TRY: 24.06 mm²/mg · LEDA: 22.57 mm²/mg · GIFT: 22.57 mm²/mg

Other traits1

Diaspore typeseed

03Chemical composition37 compounds

Compounds documented for Euphorbia cyparissias across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cycloartane triterpenoids10

Glutinane triterpenoids6

Monomeric stilbenes3

Phenanthrenes3

Oleanane triterpenoids2

Documented compounds37 total

Compound	Amount	Source
(1S,3R,6S,8R,11R,12R,15S,16S)-7,7,12,16-tetramethyl-15-[(2R)-6-methyl-5-methylideneheptan-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	LOTUS
(1S,3R,6S,8R,11R,12S,15R,16R)-15-[(2R,5R)-5-hydroperoxy-6-methylhept-6-en-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	LOTUS
(1S,3R,6S,8R,11R,12S,15R,16R)-15-[(2R,5R)-5-hydroxy-6-methylhept-6-en-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	LOTUS
(1S,3R,6S,8R,11R,12S,15R,16R)-15-[(Z)-6-hydroxy-6-methylhept-2-en-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	LOTUS
(1S,3R,6S,8R,11R,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methyl-5-methylideneheptan-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	LOTUS
(1S,3R,6S,8R,11R,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methylhept-6-en-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	LOTUS
(1S,3R,6S,8S,11S,12R,15R,16R)-15-[(E,2S)-6-hydroxy-6-methylhept-4-en-2-yl]-7,7,12,16-tetramethylpentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	LOTUS
(3R,3aR,5aS,7aR,11aS,13aS,13bR)-3a,5a,8,8,11a,13a-hexamethyl-3-propan-2-yl-2,3,4,5,6,7,7a,10,11,12,13,13b-dodecahydro-1H-cyclopenta[a]chrysen-9-one	present	LOTUS
(4aR,6aR,6aR,6bR,8aS,12aR,14aR,14bR)-4,4,6a,6b,8a,11,12,14b-octamethyl-2,3,4a,5,6,6a,7,8,9,12,12a,13,14,14a-tetradecahydro-1H-picen-3-ol	present	LOTUS
(4aR,6aR,6aS,8aR,12aS,14aR,14bR)-4,4,6a,6a,8a,11,11,14b-octamethyl-2,4a,5,6,8,9,10,12,12a,13,14,14a-dodecahydro-1H-picen-3-one	present	LOTUS

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia cyparissias has left across the world's sequence archives.

At a glance

DNA specimens58

Marker genes9

GenBank sequences10

eDNA detections31

Countries8

The DNA barcodea real sequence read deposited for this species

ITSPZ036570.1 ↗698 bpCzechia · 2020

ACGT

TCGAAACCTGCCTAGCAGAACGACCCGCGAACGCGTTTATAAATCGAGGGATCGGCGCGGGACTCGTCCGGCGTCGATCTCTCAACGGGG …

Euphorbia cyparissias isolate Ecyparissias_16505 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matKrbcL1rbcLaITS9ITS1ITS2atpF-atpHrpoC1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Euphorbia cyparissias carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 350 687 857 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Euphorbia cyparissias1.35 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidypolyploid inferred

Chromosome records20–502n range36median20mode44records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2021×GoaT · Tree of Sex Database · CCDB · slov-fl · CCDB · brit-fl +7

GoaT · Tree of Sex Database — ↗

CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.

CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.

CCDB · brit-fl — Rutland, J.P. New Phytol. 40: 210-214 (1941)

CCDB · brit-fl — Pritchard, T.O. (1958)

CCDB · iber-fl — Euphorbia L. subsect. Esula (Boiss. in DC.) Pax in the Iberian Peninsula. Leaf surface, chromosome numbers and taxonomic treatment. Molero, J. & A. M. Rovira.Collect. Bot. (Barcelona)21: 142(1992).

CCDB · fl-europaea — Pritchard, 1957

CCDB · ipcn-api-dl — Molero, J. & A. M. Rovira. 1992. Euphorbia L. subsect. Esula (Boiss. in DC.) Pax in the Iberian Peninsula. Leaf surface, chromosome numbers and taxonomic treatment. Collect. Bot. (Barcelona) 21: 121–181.

CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.

CCDB · book-ipcn72 — KLIPHUIS, E . & J.H. WIEFFERING. 1972. Chromosome numbers of some Angiosperms from the South of France. Acta Bot. Neer!. 21: 598-604.

CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.

CCDB · Cave1963 — Gadella & Klip. 1963

CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.

CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1966). Chromosome numbers of flowering plants in the Netherlands II. Proc. Kon. Ned. Akad. Wetensch. Ser. C 69(5): 541-556.

CCDB · CromoCat 2015 — Kliphuis, E. & Wieffering, J. H. (1972). Chromosome numbers of some Angiosperms from the South of France. Acta Bot. Neerl. 21: 598-604.

CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1974). Cytotaxonomical Atlas of the Slovenian Flora. J. Cramer Vaduz

CCDB · CromoCat 2015 — Molero, J. & A. M. Rovira. (1992). Euphorbia L. subsect. Esula (Boiss. in DC.) Pax in the Iberian Peninsula. Leaf surface, chromosome numbers and taxonomic treatment. Collect. Bot. (Barcelona) 21: 121-181.

CCDB · CromoCat 2015 — Perry, B. A. (1943). Chromosome numbers and phylogenetic relationships in the Euphorbiaceae. Amer. J. Bot. 30: 527-543.

CCDB · CromoCat 2015 — Pritchard, T. (1958). The genecology of weed species. Studies on Euphorbia cyparissias L. and Hypericum perforatum L. Tesis Leeds

CCDB · CromoCat 2015 — Rutland, J. P. (1941). The Merton Catalogue. A list of chromosome numbers of British plants. New Phytol. 40(3): 210-214.

CCDB · CromoCat 2015 — Shimoyama, S. (1959). Cytological studies in the genus Euphorbia, III. Ann. Rept. Natl. Inst. Genet. (Japan) 8: 49.

2n 4017×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · brit-fl +6

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ita-fl — SCHULZ-SCHAEFFERJ., GERHARDT S. - 1987. Cytotaxonomic analysis of the Euphorbia spp. ("Leafy Spurge") complex.. Biol. Zent. Bl. , 106: 429-438.

CCDB · brit-fl — Pritchard, T.O. (1958)

CCDB · fl-europaea — Pritchard, 1957

CCDB · poland — Bauer Z. 1971. Karyological studies iu the genus Euphorbia L. II. Acta Biol. Cracov. Ser. Bot. 14, 159-178.

CCDB · ipcn-api-dl — Strid, A. & I. A. Andersson. 1985. Chromosome numbers of Greek mountain plants. An annotated list of 115 species. Bot. Jahrb. Syst. 107: 203–228.

CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.

CCDB · ipcn-api-dl — Wiebecke, W. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.

CCDB · book-ipcn67-71 — MOORE, R.J.' & c. FRANKTON. 1969. Euphorbia x pseudo-esula (~. cyparissias X ~ esula) in Canada. Canad. Field-Naturalist 83: 243-246.

CCDB · book-ipcn67-71 — BAUER, z. 1971. Karyological studies in the genus Euphorbia L. II. Acta Biol. Cracov., Ser. Bot. 14: 159-178.

CCDB · kew — Vidic T, Greilhuber J, Vilhar B, Dermastia M. 2009. Selective significance of genome size in a plant community with heavy metal pollution. Ecological Applications 19: 1515-1521.

CCDB · CromoCat 2015 — Bauer, Z. (1971). Karyological studies on the genus Euphorbia L. II. Acta Biol. Cracov., Ser. Bot. 14: 159-178.

CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.

CCDB · CromoCat 2015 — Pritchard, T. (1958). The genecology of weed species. Studies on Euphorbia cyparissias L. and Hypericum perforatum L. Tesis Leeds

CCDB · CromoCat 2015 — Schulz-Schaeffer, J. & S. Gerhardt. (1989). Cytotaxonomic analysis of the Euphorbia spp. ("leafy spurge") complex. II. Comparative study of the chromosome morphology. Biol. Zentralbl. 108(1):69-76.

CCDB · CromoCat 2015 — Strid, A. & I. A. Andersson. (1985a). Chromosome numbers of Greek mountain plants. An annotated list of 115 species. Bot. Jahrb. Syst. 107: 203-228.

CCDB · CromoCat 2015 — Wiebecke, W. (1989). Beiträge zur Karyosystematik von Euphorbia und verwandten Gattungen. Diss. Universität Wien. pp. 188.

2n 363×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015

CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.

CCDB · CromoCat 2015 — Schulz-Schaeffer, J. & S. Gerhardt. (1987). Cytotaxonomic analysis of the Euphorbia spp. ("leafy spurge") complex. Biologisches Zentralblatt 106: 429-438

CCDB · CromoCat 2015 — Zhukova, P. G. (1967). Kariology of some plants, cultivated in the Arctic-Alpine Botanical Garden.N. A. Avrovin (eds.), Plantarum in Zonam Polarem Transportatio. II. 2: 139-149. Leningrad.

2n 503×CCDB · ipcn-api-dl · CCDB · CromoCat 2015 · TreeOfSex · plant

CCDB · ipcn-api-dl — Wiebecke, W. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.

CCDB · CromoCat 2015 — Wiebecke, W. (2000). In C. Dobeš & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna NONE LISTED

TreeOfSex · plant — Goldblatt1979 ↗

n 102×CCDB · CromoCat 2015 · TreeOfSex · plant

CCDB · CromoCat 2015 — Stahevitch, A. E., C. W. Crompton & W. A. Wojtas. (1988). Cytogenetic studies of leaf spurge, Euphorbia esula and its allies (Euphorbiaceae). Canad. J. Bot. 66: 2247-2257.

TreeOfSex · plant — Goldblatt1979 ↗

n 201×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Stahevitch, A. E., C. W. Crompton & W. A. Wojtas. (1988). Cytogenetic studies of leaf spurge, Euphorbia esula and its allies (Euphorbiaceae). Canad. J. Bot. 66: 2247-2257.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~1.42 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.42 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Dietphotoautotroph

08Occurrence & distribution

Record type434 207 records

Wild obs. + sensor413 896

Museum / vouchered14 597

Cultivated / captive447

Other5 267

Origin

Native19

Introduced993

Range

Area of Occupancy AOO387 652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 85 847≤1 km 28 944≤10 km 171 735>10 km 3 415

289 941 georeferenced · 123 955 without coordinates

Open the mapobservation + sensor413 896

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 734≤1 km 2 551≤10 km 6 548>10 km 376

10 209 georeferenced · 4 388 without coordinates

Open the institutions mapphysical evidence14 597

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 446 without coordinates

Open the mapnot free-living447

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions172 of 285 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	6 678
BFLlocation not on record	631
BIO-UNIPIlocation not on record	551
BRNUlocation not on record	439
LDlocation not on record	311
Salzburg, AT	227
Görlitz, DE	217
Philadelphia, US	214
Helsinki, FI	194
Karlsruhe, DE	168
Paris, FR	161
Olocation not on record	150
Madison, US	143
Uniwersytet Warszawskilocation not on record	135
Chicago, US	133
Berlin, DE	128
BDBClocation not on record	119
Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record	118
Oskarshamn, SE	113
Adam Mickiewicz University in Poznańlocation not on record	102
SLU Artdatabankenlocation not on record	101
Chongqing Museumlocation not on record	97
Barcelona, ES	96
Moscow State Universitylocation not on record	87
St. Paul, US	85
Québec, CA	82
KMNlocation not on record	66
Provincia di Livornolocation not on record	64
University of New Hampshirelocation not on record	60
Ann Arbor, US	58
Green Bay, US	55
Brussel, BE	48
Oulu, FI	46
Tartu, EE	45
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	43
New Haven, US	43
Burlington, US	42
Acadia Universitylocation not on record	36
Allentown, US	35
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	34
MAlocation not on record	34
Mlocation not on record	33
Turku, FI	31
Bergen, NO	30
Bloomington, US	29
Bronx, US	29
BClocation not on record	29
Bern, CH	28
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	28
Williamsburg, US	27
Uniwersytet Opolskilocation not on record	27
College Park, US	27
Institut und Museum fuer Geologie und Palaeontologielocation not on record	25
Philadelphia, US	24
Toronto, CA	23
Uppsala, SE	23
València, ES	22
Trondheim, NO	21
GJOlocation not on record	20
GZUlocation not on record	20
Tallinn, EE	19
San Jose State University, Museum of Birds and Mammalslocation not on record	19
Frankfurt am Main	18
Wlocation not on record	18
Porrentruy, CH	17
SZUlocation not on record	16
TUR-Alocation not on record	16
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	16
Jyväskylä, FI	16
University of Wisconsinlocation not on record	15
PrivatHerblocation not on record	15
Hobart, AU	15
Kuopio, FI	15
Bozeman, US	15
Uniwersytet Śląski w Katowicachlocation not on record	14
Norfolk, US	13
Canadian Department of Agriculturelocation not on record	13
Saint Louis, US	13
WTUlocation not on record	12
South Kensington, GB	12
MeiseBGlocation not on record	12
Staten Island, US	12
IDElocation not on record	12
Stockholm, SE	12
Fayetteville, US	12
Saint John, CA	12
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	12
Pullman, US	11
Vancouver, CA	11
Fort Worth, US	11
DBF-NHMDlocation not on record	11
KIRMlocation not on record	10
Dresden, DE	10
Glarus, CH	10
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	10
Corvallis, US	9
Montréal, CA	9
Fulda, DE	9
Keene State Universitylocation not on record	9
PRClocation not on record	9
Millersville, US	8
TROMlocation not on record	8
Auckland, NZ	8
Emporia, US	8
Vitoria, ES	8
CICYTEXlocation not on record	8
College of the Atlantic, Museumlocation not on record	8
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	8
Dekalb, US	8
Tuscaloosa, US	8
Université Lavallocation not on record	7
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	7
Otaru, JP	7
Moscow, US	7
Tilburg, NL	7
BGBMlocation not on record	7
Natural History Museum Rotterdamlocation not on record	7
Whitewater, US	7
Wuzhou, CN	6
Morgantown, US	6
Bangkok, TH	6
Adelaide, AU	6
Chapel Hill, US	6
H-Schuhwlocation not on record	6
University of Stellenboschlocation not on record	6
Mississippi State, US	6
Davenport, US	6
Salamanca, ES	5
GAlocation not on record	5
Naturalis Biodiversity Centerlocation not on record	5
Frauenfeld, CH	5
Boise, US	5
Cheney, US	5
Ivano-Frankove, UA	5
Porvoo, FI	5
US	5
Denver, US	5
Madrid, ES	5
Chiba, JP	5
Chicago, US	5
Herb. BBGlocation not on record	4
Conservatoire botanique national du Bassin parisienlocation not on record	4
Austin, US	4
BAYLUlocation not on record	4
Kingston, US	4
Tacoma, US	4
nbflocation not on record	4
Dover, US	4
EL PASO, US	4
Flagstaff, US	4
Knoxville, US	4
Victoria, CA	3
Whitehorse, CA	3
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	3
Philadelphia, US	3
Museo Entomologico de Leonlocation not on record	3
JP	3
Armidale, AU	3
Entomological Society of Latvialocation not on record	3
New Brunswick, US	3
Portland, US	3
AUAlocation not on record	3
Rovaniemi, FI	3
Monastir, TN	3
CJBGlocation not on record	3
Sion, CH	3
Alicante, ES	3
Nagano City, JP	3
Bourges, FR	3
Waverly, US	3
Zürich, CH	3
University of Guelph, OAC Herbariumlocation not on record	3
LfUlocation not on record	3
Beijing, CN	3
Tula State Universitylocation not on record	3
H-Adlerlocation not on record	3
Taipei, TW	2
Musee National d'histoire Naturelle Luxembourglocation not on record	2
UoB-IBlocation not on record	2
Podgorica, ME	2
McWane Science Centerlocation not on record	2
Black Rock Forest Consortiumlocation not on record	2
Forssa, FI	2
Northridge, US	2
Sant Julià de Lòria, AD	2
Kushiro City Museumlocation not on record	2
Dhaka, BD	2
DULlocation not on record	2
Jackson, US	2
Washington, US	2
San Sebastián, ES	2
Muséum Henri Lecoqlocation not on record	2
Tromso University Museumlocation not on record	2
Wellington, NZ	2
Museo Achille Folettolocation not on record	2
Obihiro Centennial City Museumlocation not on record	2
Caldwell, US	2
Pittsburg, US	2
Santa Barbara, US	2
Kew, GB	2
Pocatello, US	2
Blumenau, BR	2
University of Alberta Museumslocation not on record	2
Universidad del Pais Vasco (UPV/EHU)location not on record	2
Hudson, US	2
University of Tennessee at Chattanoogalocation not on record	2
Springfield, US	2
Christchurch, NZ	2
BSBIlocation not on record	2
University of North Carolina at Pembrokelocation not on record	2
Salvador, BR	2
Granada, ES	2
Durham, US	2
Nijmegen, NL	2
Chadron, US	2
DOI/NPS, Greenbelt Parklocation not on record	1
Canberra, AU	1
Trois-Rivières, CA	1
ULBF-AGRlocation not on record	1
	1
GB	1
University of Southern Mississippilocation not on record	1
Sendai, JP	1
Bend, US	1
Missoula, US	1
Museum of the Rockieslocation not on record	1
Phoenix, US	1
NMWlocation not on record	1
Kunming, CN	1
FLADlocation not on record	1
San Angelo, US	1
Spearfish, US	1
Albuquerque, US	1
Badajoz, ES	1
IWEP FEB RASlocation not on record	1
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	1
Asheville, US	1
Johnson City, US	1
Logan, US	1
Sagamihara, JP	1
China Agricultural Universitylocation not on record	1
Cambridge University Herbariumlocation not on record	1
Tampa, US	1
Fairfax, US	1
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	1
University of British Columbia, Herbariumlocation not on record	1
Pamplona, ES	1
Voronezh State Universitylocation not on record	1
UNINE:NEUlocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
Anchorage, US	1
Tsukuba, JP	1
Honolulu, US	1
Banyoles, ES	1
Mexico City, MX	1
Odawara, JP	1
Columbia, US	1
National Institute of Biological Resourceslocation not on record	1
Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze \| Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record	1
Henderson, US	1
Royal Botanical Gardenslocation not on record	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Madrid, ES	1
Due West, US	1
Fribourg, CH	1
Fukushima Universitylocation not on record	1
Lubbock, US	1
Riverside, US	1
UGentlocation not on record	1
Toyama, JP	1
Zürich, CH	1
IPE-CSIClocation not on record	1
H-Wolflocation not on record	1
Lord Fairfax Community Collegelocation not on record	1
Macomb, US	1
UIBlocation not on record	1
LUXEMBOURG, LU	1
Mohonk Preservelocation not on record	1
Fredericksburg, US	1
Xiamen, CN	1
Severin-McDaniel Insect Collectionlocation not on record	1
Ashland, US	1
Lincoln, US	1
Musée des Confluenceslocation not on record	1
Oswego, US	1

285 institutions · 13 727 of 14 597 vouchered records shown · 769 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA31 detections

Where the DNA of Euphorbia cyparissias was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map7 countries0

Hillside at edge of Pinus stobus forest, wit…Clay soil, on a slight slope (facing west) i…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 3.90–18.0

Seasonal swing summer↔winter17.2 °C

Max temp (day)17.9 °C 5.70–22.0

Min temp (night)8.10 °C 2.10–13.6

Precipitation78.7 mm/mo 57.7–117

Air humidity60.2 % 55.3–65.1

Moisture balance-20.6 mm/mo -47.0–71.7

Vapour deficit651 Pa 280–846

Wind speed3.70 m/s 2.50–5.50

Cloud cover42.7 % 35.1–56.2

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources15 archives

Size & morphology15

Life cycle & reproduction13

Diet & foraging2

Habitat & environment13

Physiology & chemistry7

Other traits1

Compound class profile5 classes

Documented compounds37 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

How it livedPBDB

Record type434 207 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions172 of 285 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type434 207 records