Euphorbia crenulata — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records471

Data sources8

Biological traits14

DNA specimens3

eDNA detections2

Sources8 archives

Databases and archives Euphorbia crenulata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility471 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF471 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Euphorbia crenulata is a species of spurge native to the western United States, especially California and Oregon. Its common name is Chinese caps. Its leaves vary in shape and size but they often curve up and come together to form a bowl shape. The small fruits are green, fleshy, and lobed. The flower has two distinct horns.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual or biennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry4

Leaf c448 mg/g

Leaf dry-matter content (LDMC)260 mg/g

Leaf n25.8 mg/g

Specific leaf area (SLA)33.66 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia crenulata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ149593.1 ↗585 bp

ACGT

TCGAAACCTGCGAAGCAGAACGACCCGCGAACTCGTTTGCAAATCGGGGGATCGTCGTTCCGGCGCCGGTCTCCCGTCGGGGCCCGGGCG …

Euphorbia crenulata voucher F. Brunett 313 (MICH) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matKrbcLaITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type471 records

Wild obs. + sensor59

Museum / vouchered412

Origin

Native1

Range

Area of Occupancy AOO1 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 31≤1 km 3≤10 km 2>10 km 6

42 georeferenced · 17 without coordinates

Open the mapobservation + sensor59

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 10≤1 km 140≤10 km 123>10 km 14

287 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence412

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions33 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Arcata, US	40
Corvallis, US	39
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	34
Davis, US	32
Chicago, US	31
Claremont, US	28
Santa Barbara, US	17
Canadian Department of Agriculturelocation not on record	15
San Luis Obispo, US	10
Angwin, US	8
Santa Cruz, US	7
CASlocation not on record	7
San Diego, US	7
Riverside, US	6
St. Paul, US	6
Pullman, US	5
US	4
Fort Worth, US	3
Irvine, US	3
San Jose, US	3
Bloomington, US	3
STNFlocation not on record	2
Moscow, US	2
WTUlocation not on record	2
Ann Arbor, US	2
Saint Louis, US	2
Tacoma, US	1
University of Stellenboschlocation not on record	1
Fullerton, US	1
Long Beach, US	1
Phoenix, US	1
Ashland, US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Northridge, US	1
Provo, US	1
Bronx, US	1
Paris, FR	1
Mexico City, MX	1
Wuzhou, CN	1
Vancouver, CA	1

40 institutions · 332 of 412 vouchered records shown · 80 without an institution code

09Environmental DNA2 detections

Where the DNA of Euphorbia crenulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 14.9–14.9

Seasonal swing summer↔winter12.6 °C

Max temp (day)20.8 °C

Min temp (night)9.80 °C

Precipitation20.8 mm/mo

Air humidity58.8 %

Moisture balance-107 mm/mo

Vapour deficit701 Pa

Wind speed2.10 m/s

Cloud cover31.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.