Euphorbia cooperi

N.E.Br. ex A.Berger · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records441

Data sources10

Biological traits19

DNA specimens4

eDNA detections3

Sources10 archives

Databases and archives Euphorbia cooperi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility441 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF441 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Euphorbia cooperi is a flowering plant in the Euphorbiaceae family. It is commonly called Transvaal candelabra tree or bushveld candelabra euphorbia, and is found in South Africa. Branches with flowers ([[cyathia]]) Branches with fruits

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height5 m

⚠ sources differ — GIFT: 5 m · TRY: 4 m

Plant height max7 m

Plant height min2 m

Life cycle & reproduction6

Deciduousnessevergreen

Life formsucculent tree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 525 m

Elevation min275 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: herb

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition2 compounds

Compounds documented for Euphorbia cooperi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Tetracyclic diterpenoids $ Tigliane diterpenoids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
[(1R,2S,6R,10S,11R,12S,13S,15R)-1,6-dihydroxy-8-(hydroxymethyl)-4,12,15-trimethyl-12-(2-methylpropanoyloxymethyl)-5-oxo-13-tetracyclo[8.5.0.02,6.011,13]pentadeca-3,8-dienyl] (E)-2-methylbut-2-enoate		present	LOTUS
[(1R,2S,6R,10S,11R,12S,13S,15R)-8-(acetyloxymethyl)-1,6-dihydroxy-4,12,15-trimethyl-12-(2-methylpropanoyloxymethyl)-5-oxo-13-tetracyclo[8.5.0.02,6.011,13]pentadeca-3,8-dienyl] (E)-2-methylbut-2-enoate		present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia cooperi has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKC019656.1 ↗626 bp

ACGT

TCGAAGCCTGCCCAACAGAATGACCCGTGAACGTGTTTATAAATCGATGGGCTGCTGCAGGATTTATCCAGCATCAGCACCTCATTAGGG …

Euphorbia cooperi voucher Berry, P.E. 7786 (MICH) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★rbcLa★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type441 records

Wild obs. + sensor431

Museum / vouchered10

Range

Area of Occupancy AOO1 048 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 225≤1 km 73≤10 km 28>10 km 18

344 georeferenced · 87 without coordinates

Open the mapobservation + sensor431

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	2
Cape Town, ZA	2
Pretoria, ZA	1
Durban, ZA	1
Saint Louis, US	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1

6 institutions · 8 of 10 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Euphorbia cooperi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 21.1–21.1

Seasonal swing summer↔winter8.90 °C

Max temp (day)26.1 °C

Min temp (night)15.8 °C

Precipitation56.1 mm/mo

Air humidity58.0 %

Moisture balance-54.0 mm/mo

Vapour deficit1,047 Pa

Wind speed2.50 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)