Euphorbia characias
speciesAt a glance
Occurrence records52 942
Data sources15
Biological traits34
DNA specimens19
eDNA detections20
Sources15 archives
Databases and archives Euphorbia characias's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility52 942 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics19 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources34 traits
Chemical compositionLOTUS · NPASS101 compounds
Occurrence & distributionGBIF52 942 records
Environmental DNA1 datasets · 5 countries20 detections
DNA & barcodingBOLD · NCBI19 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2n = 20
01Narrative
L'Euphorbe characias ou Euphorbe des garrigues est une espèce de plantes de la famille des Euphorbiacées, originaire du pourtour méditerranéen. Deux principales sous-espèces se trouvent dans différentes régions du bassin méditerranéen. Elles peuvent souvent s'hybrider entre elles : - E. characias subsp. characias, du Portugal à la Crète - E. characias subsp. wulfenii, du sud de la France à l'Anatolie. Des variétés horticoles sont souvent utilisées pour l'ornement dans les jardins. De nombreux hybrides ont été obtenus par croisement avec Euphorbia amygdaloides. La célèbre paysagiste Gertrude Jekyll considérait cette euphorbe comme une de ses plantes favorites.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPLEDAGIFTTRY
Size & morphology7
Leaf length max70 mm
Plant height0.65 m
⚠ sources differ — GIFT: 0.65 m · TRY: 0.933 m
Plant height max1.2 m
Seed length3 mm
Seed length max3 mm
Seed length min3 mm
Seed mass3.74 mg
Life cycle & reproduction9
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: unspecialized
Life formsubshrub
Life spanperennial
Lifespan years6 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
Reproduction asexualabsent
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Growth formshrub
Habitat GIFTLowland
Mycorrhiza typenon-ectomycorrhizal
Woodinesswoody
Physiology & chemistry6
Leaf dry-matter content (LDMC)292 mg/g
Leaf n20.3 mg/g
Leaf p1.1 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)11.0 mm²/mg
03Chemical composition101 compounds
Compounds documented for Euphorbia characias across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Jatrophane diterpenoids13
Neutral glycosphingolipids12
Aporphine alkaloids $ Isoquinoline alkaloids10
Lathyrane diterpenoids10
Aporphine alkaloids6
Documented compounds101 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Berbamine | present | NPASS | |
| (+)-Ursolic Acid | present | NPASS | |
| (-)-Phanostenine | present | NPASS | |
| (-)-Roemeroline | present | NPASS | |
| (12S)-15,16-dimethoxy-11-methyl-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14(19),15,17-hexaene | present | NPASS | |
| (14aS,26aR)-2,3,13,14,14a,15,26,26a-Octahydro-22,30-dimethoxy-14-methyl-1H-4,6:16,19-dietheno-21,25-metheno-12H-[1,3]dioxolo[4,5-g]pyrido[2 inverted exclamation marka,3 inverted exclamation marka:17,18][1,10]dioxacycloeicosino[2,3,4-ij]isoquinoline | present | NPASS | |
| (1R,2S,4S,7S,9R,10E,13R,15R,16R)-13,15,16-trihydroxy-4,8,8,11,15-pentamethyl-3-oxatetracyclo[11.3.0.02,4.07,9]hexadec-10-en-12-one | present | LOTUS | |
| (1S,10S)-3-hydroxy-6-[(1S,10S)-3-hydroxy-4,11,12-trimethoxy-17-methyl-13-oxo-17-azatetracyclo[8.4.3.01,10.02,7]heptadeca-2(7),3,5,11-tetraen-6-yl]-4,11,12-trimethoxy-17-methyl-17-azatetracyclo[8.4.3.01,10.02,7]heptadeca-2(7),3,5,11-tetraen-13-one | present | NPASS | |
| (2R)-2-hydroxy-N-[(Z,2S,3S,4R,5R)-3,4,5-trihydroxy-1-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoctadec-6-en-2-yl]octacosanamide | present | LOTUS | |
| (2R)-N-[(Z,2S,3S,4R)-3,4-dihydroxy-1-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoctadec-8-en-2-yl]-2-hydroxyheptacosanamide | present | LOTUS |
05DNA & barcoding19 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia characias has left across the world's sequence archives.
At a glance
DNA specimens19
Marker genes5
GenBank sequences10
eDNA detections20
Countries5
The DNA barcodea real sequence read deposited for this species
TCGAAACCTGCAGCAGAACGACCCGTGAACGTGTTTACAAACTGAGGGATCGTCGTTGGATTCGTCCGGCGTCAATCCTCATCTAGGTTC …
Euphorbia characias isolate 14736 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★ITS10★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Euphorbia characias carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidydiploid inferred
Chromosome records20–202n range20median20mode53records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2053×GoaT · Tree of Sex Database · CCDB · ita-fl · CCDB · iber-fl +9
GoaT · Tree of Sex Database — ↗
CCDB · ita-fl — CESCA G. - 1967. Osservazioni citotassonomiche su Euphorbia apios L., E. ceratocarpa Ten., E. amygdaloides L. s.l., E. characias L. s.l.. Arch. Bot. Biogeogr. Ital. , 43(12) (4): 280-291.
CCDB · ita-fl — LARSEN K. - 1956. Chromosome studies in some Mediterranean and South European flowering plants.. Bot. Not. , 109(3): 293-307.
CCDB · ita-fl — BIANCO P., D'EMERICO S., MEDAGLI P. - 1991 (1990). Numeri cromosomici per la flora italiana: 1239-1243.. Inform. Bot. Ital. , 22(3): 237-239.
CCDB · ita-fl — D'Emerico S., Pignone D., Vita F., Scrugli A. - 2000. Contributo alla cariologia di Euphorbia characias L. (Euphorbiaceae). "Problematiche di Biologia Vegetale in Ambiente Mediterraneo", 95 Congresso della S.B.I. , : 75.
CCDB · ita-fl — PAVONE P., TERRASI M.C., ZIZZA A. - 1981. Chromosome number reports LXXII.. Taxon , 30(3): 695-696.
CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XI. Euphorbiaceae Queirs, M.Bol. Soc. Brot. ser. 249: 143-161(1975).
CCDB · iber-fl — Nmeros cromossmicos para a flora portuguesa, 16-37. Queirs, M.Bol. Soc. Brot. ser. 253: 5-28(1979).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 225-239. Garca, I. & B. Valds.Lagascalia10(2): 241-247(1981).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3119
CCDB · fl-europaea — Larsen, 1956a
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
CCDB · ipcn-api-dl — Bianco, P., S. D'Emerico & P. Medagli. 1990. Numeri cromosomici per la flora Italiana: 1239--1243. Inform. Bot. Ital. 22: 237–239.
CCDB · ipcn-api-dl — Pavone, P., C. M. Terrasi & A. Zizza. 1981. In Chromosome number reports LXXII. Taxon 30: 695–696.
CCDB · ipcn-api-dl — Queiros, M. 1979. Numeros cromosomicos para a Flora Portuguesa 16-37. Bol. Soc. Brot., sér. 2 2, 53: 15–28.
CCDB · ipcn-api-dl — Queiros, M. 1975a. Contribuicao para o conhecimento citotaxonomico das Spermatophyta de Portugal. XI. Euphorbiaceae. Bol. Soc. Brot., sér. 2 49: 143–161.
CCDB · ipcn-api-dl — D'Emerico, S., D. Pignone, F. Vita & A. Scrugli. 2003. Karyomorphological analyses and chromatin characterization by banding techniques in Euphorbia characias L. and E. wulfenii Hoppe (= E. veneta Willd.) (Euphorbiaceae). Caryologia 56(4): 501–508.
CCDB · ipcn-api-dl — Benedi, C. & C. Blanché. 1992. IOPB chromosome data 4. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 18/19: 6.
CCDB · ipcn-api-dl — Garcia, I. & B. VALDES. 1981. In Numeros cromosomicos para la flora EspaPiola. 182-256. Lagascalia 10: 225–256.
CCDB · ipcn-api-dl — Natarajan, G. 1977. Contribution à l'etude caryosystematique des especes de la garrigue languedocienne. These, Academie de Montpellier, France.
CCDB · ipcn-api-dl — Natarajan, G. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Aboucaya, A. & R. Verlaque. 1990. IOPB chromosome data 2. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 15: 10–11.
CCDB · book-ipcn67-71 — CESCA, G. 1967. osservazioni citotassonomiche su Euphorbia apios L., E. ceratocarpa Ten., E. amygdaloides L. s.)., E. characias L. s.). Arch. Bot. Biogeogr. Ital. 43: 280-290.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · book-atlas-flowering-plants — Europe
CCDB · book-atlas-flowering-plants — Sicily
CCDB · Cave1956 — Larsen a
CCDB · CromoCat 2015 — Larsen, K. (1956a). Chromosome studies in some Mediterranean and south European flowering plants. Bot. Not. 109(3): 293-307.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
CCDB · CromoCat 2015 — Luque, T. & Díaz Lifante, Z. (1991). Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303-364.
CCDB · CromoCat 2015 — Pavone, P., C. M. Terrasi & A. Zizza. (1981b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 695-696.
CCDB · CromoCat 2015 — Queirós, M. (1975b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XI. Euphorbiaceae. Bol. Soc. Brot. 49: 143-161.
CCDB · CromoCat 2015 — Queirós, M. (1979). Números cromossómicos para a flora portuguesa, 16-37. Bol. Soc. Brot. 53: 5-28.
CCDB · CromoCat 2015 — Benedí, C. & Blanché, C. (1992). IOPB Chromosome Data 4 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 18-19: 6.
CCDB · CromoCat 2015 — Natarajan, G. (1978b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 526-531.
CCDB · CromoCat 2015 — Cesca, G. (1967). Osservazioni citotassonomiche su Euphorbia apios L., E. ceratocarpa Ten., E. amygdaloides L. s. l., E. characias L. s. l Arch. Bot. Biogeogr. Ital. 43: 280-290.
CCDB · CromoCat 2015 — García, I. & Valdés, B. (1981). Números cromosómicos para la flora española, 225-239. Lagascalia 10(2): 241-247
TreeOfSex · plant — Goldblatt1979 ↗
n 106×CCDB · ita-fl · CCDB · iber-fl · CCDB · ipcn-api-dl +2
CCDB · ita-fl — D'AMATO F. - 1939. Ricerche embriologiche e cariologiche sul genere "Euphorbia".. N. Giorn. Bot. Ital., n.s. , 46(3): 470-509.
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 225-239. Garca, I. & B. Valds.Lagascalia10(2): 241-247(1981).
CCDB · ipcn-api-dl — Garcia, I. & B. VALDES. 1981. In Numeros cromosomicos para la flora EspaPiola. 182-256. Lagascalia 10: 225–256.
CCDB · CromoCat 2015 — D'Amato, F. (1939). Ricerche embriologiche e cariologiche sul genere Euphorbia. Nuovo Giorn. Bot. Ital. 46: 470-508.
CCDB · CromoCat 2015 — García, I. & Valdés, B. (1981). Números cromosómicos para la flora española, 225-239. Lagascalia 10(2): 241-247
TreeOfSex · plant — Goldblatt1979 ↗
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.700 ↗
08Occurrence & distribution
Record type52 942 records
Wild obs. + sensor51 682
Museum / vouchered819
Cultivated / captive4
Other437
Origin
Native2 252
Introduced483
Range
Area of Occupancy AOO70 912 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy69% within 1 km
≤100 m 23 516≤1 km 4 489≤10 km 12 278>10 km 240
40 523 georeferenced · 11 159 without coordinates
Open the mapobservation + sensor51 682
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy56% within 1 km
≤100 m 23≤1 km 114≤10 km 104>10 km 5
246 georeferenced · 573 without coordinates
Open the institutions mapphysical evidence819
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 2
2 georeferenced · 2 without coordinates
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions42 of 69 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 189 |
| Paris, FR | 89 |
| València, ES | 71 |
| MAlocation not on record | 42 |
| Barcelona, ES | 35 |
| College of the Atlantic, Museumlocation not on record | 32 |
| LDlocation not on record | 30 |
| BDBClocation not on record | 28 |
| BClocation not on record | 19 |
| Berlin, DE | 18 |
| CICYTEXlocation not on record | 17 |
| UIBlocation not on record | 15 |
| Vitoria, ES | 12 |
| Chicago, US | 12 |
| Wlocation not on record | 12 |
| Córdoba, ES | 11 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 11 |
| Alicante, ES | 10 |
| Canadian Department of Agriculturelocation not on record | 8 |
| MeiseBGlocation not on record | 7 |
| Sevilla, ES | 7 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| Christchurch, NZ | 7 |
| Phyletisches Museum Jenalocation not on record | 6 |
| Wellington, NZ | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| WTUlocation not on record | 5 |
| Granada, ES | 4 |
| Kew, GB | 4 |
| Canberra, AU | 4 |
| Portland, US | 4 |
| Ann Arbor, US | 3 |
| Salamanca, ES | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| Badajoz, ES | 3 |
| Bourges, FR | 3 |
| Auckland, NZ | 3 |
| Oskarshamn, SE | 2 |
| Davis, US | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| CJBNlocation not on record | 2 |
| BRNUlocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| Karlsruhe, DE | 2 |
| Provincia di Livornolocation not on record | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Saint Louis, US | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Rotorua, NZ | 1 |
| Claremont, US | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Jaén, ES | 1 |
| Hobart, AU | 1 |
| Görlitz, DE | 1 |
| Riverside, US | 1 |
| Universite de Montpellierlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Frankfurt am Main | 1 |
| Sevilla, ES | 1 |
| ESP145location not on record | 1 |
| Madrid, ES | 1 |
| Monastir, TN | 1 |
| San Diego, US | 1 |
| Santa Barbara, US | 1 |
| South Kensington, GB | 1 |
| Québec, CA | 1 |
| Vancouver, CA | 1 |
| Madrid, ES | 1 |
| Corvallis, US | 1 |
69 institutions · 787 of 819 vouchered records shown · 30 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Euphorbia characias was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map5 countries0
Non coniferous evergreen forestsscrubland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.5 °C 9.50–17.6
Seasonal swing summer↔winter19.6 °C
Max temp (day)18.9 °C 12.2–22.4
Min temp (night)9.30 °C 6.50–11.7
Precipitation72.2 mm/mo 37.4–80.8
Air humidity58.3 % 53.5–61.8
Moisture balance-20.6 mm/mo -85.8–-3.40
Vapour deficit782 Pa 514–1,034
Wind speed2.60 m/s 2.40–4.40
Cloud cover40.9 % 38.8–50.4
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.