Euphorbia bourgaeana

J.Gay ex Boiss. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records42

Data sources9

Biological traits0

DNA specimens5

eDNA detections5

Sources9 archives

Databases and archives Euphorbia bourgaeana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility42 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF42 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceGoaT · TreeOfSex2n = 18

01Narrative

Euphorbia bourgaeana is a species of flowering plant in the spurge family Euphorbiaceae. It is native to Tenerife in the Canary Islands.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia bourgaeana has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences10

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ900587.1 ↗632 bpSpain

ACGT

TCGAAACCTGCCCAGCAGAACGACCCGCGAACGTGTTTATAAGCCGAGGGATCGCCGTCGGATTCGTCCGGCGTCGATCTCTCACCGGGG …

Euphorbia bourgaeana voucher Molero 11_2007 (BCN) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Euphorbia bourgaeana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×GoaT · Tree of Sex Database · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

TreeOfSex · plant — Goldblatt1979 ↗

08Occurrence & distribution

Record type42 records

Wild obs. + sensor17

Museum / vouchered25

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 17

17 georeferenced

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 3

9 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BClocation not on record	9
Auckland, NZ	6
Ann Arbor, US	3
College of the Atlantic, Museumlocation not on record	1

4 institutions · 19 of 25 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Euphorbia bourgaeana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C

Min temp (night)9.00 °C

Precipitation33.4 mm/mo

Air humidity52.9 %

Moisture balance-61.7 mm/mo

Vapour deficit953 Pa

Wind speed2.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)