Euphorbia boetica

Boiss. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records389

Data sources12

Biological traits7

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Euphorbia boetica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility389 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS · NPASS24 compounds

Occurrence & distributionGBIF389 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · TreeOfSex2n = 18

01Narrative

Euphorbia boetica é uma espécie de planta com flor pertencente à família Euphorbiaceae. A autoridade científica da espécie é Boiss., tendo sido publicada em Centuria Euphorbiarum 36. 1860.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formperennial or subshrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment3

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

03Chemical composition24 compounds

Compounds documented for Euphorbia boetica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Stigmastane steroids5

N-acyl amines4

Arylnaphthalene and aryltetralin lignans2

Lanostane, Tirucallane and Euphane triterpenoids2

Friedelane triterpenoids2

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,3R,4S,5S,7R,9R,10R,11S,13S,15R)-2,4,7,9,15-pentahydroxy-1-(hydroxymethyl)-5,9,12,12-tetramethyltetracyclo[8.5.0.03,7.011,13]pentadecan-8-one	present	LOTUS
(2E,4E,8E,10Z,14Z)-N-(2-methylpropyl)octadeca-2,4,8,10,14-pentaen-12-ynamide	present	NPASS
(2R,3R,4S,5S,6S)-2-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(3S,17S)-4,4,9,13,14-pentamethyl-17-[(2R)-6-methylhept-5-en-2-yl]-2,3,7,8,10,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
24-Methylene-24-dihydrolanosterol acetate	present	LOTUS
24-Methylenecycloartan-3-ol	present	LOTUS
[(3S,5R,6R,8S,9S,10R,13R,14S,17R)-6-acetyloxy-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-5-hydroxy-10,13-dimethyl-1,2,3,4,6,7,8,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-3-yl] acetate	present	LOTUS
beta-Sitosterol	present	LOTUS
Cycloartenol	present	LOTUS
Cycloeucalenol	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia boetica has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ900580.1 ↗631 bpSpain

ACGT

TCGAAACCTGCCCAGCAGAACGACCCGTGAACACGTTATTAAACCGGGGGATCGCCGTGGGATCTGTCCGGCGACGATCCCTCACCAAGG …

Euphorbia boetica voucher Molero 18_2007 (BCN) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4★ITS2

fungal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Euphorbia boetica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×GoaT · Tree of Sex Database · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

TreeOfSex · plant — Goldblatt1979 ↗

08Occurrence & distribution

Record type389 records

Wild obs. + sensor283

Museum / vouchered106

Origin

Native53

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 41≤1 km 65≤10 km 98>10 km 1

205 georeferenced · 78 without coordinates

Open the mapobservation + sensor283

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 10≤1 km 19≤10 km 26

55 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College of the Atlantic, Museumlocation not on record	22
ISAlocation not on record	17
MAlocation not on record	14
BClocation not on record	11
Barcelona, ES	10
Wlocation not on record	10
València, ES	7
Entomological Society of Latvialocation not on record	5
Granada, ES	3
Phyletisches Museum Jenalocation not on record	2
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Chicago, US	1

12 institutions · 103 of 106 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Euphorbia boetica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C

Min temp (night)9.00 °C

Precipitation33.4 mm/mo

Air humidity52.9 %

Moisture balance-61.7 mm/mo

Vapour deficit953 Pa

Wind speed2.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)