Euphorbia arahaka — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records32

Data sources7

Biological traits12

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Euphorbia arahaka's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF32 records

DNA & barcodingNCBIsequences

01Narrative

Euphorbia arahaka is a species of plant in the family Euphorbiaceae. It is endemic to Madagascar. Its natural habitats are subtropical or tropical dry forests, subtropical or tropical dry shrubland, and sandy shores. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formsemisucculent shrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Succulenceyes

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia arahaka has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSKC019542.1 ↗622 bp

ACGT

TCGAAACCTGCCCAGCAGAACGACCCGTGAACATGTTCATAAATCGAGGTGTCGTCGCGGGATTCGTCCAACGTCGTCACCTCACTAGGC …

Euphorbia arahaka voucher Dorsey, B.L. 177 (MICH) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type32 records

Museum / vouchered32

Range

Area of Occupancy AOO56 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 32 records without

Open the institutions mapphysical evidence32

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	29
Ann Arbor, US	2
Kew, GB	1

3 institutions · 32 of 32 vouchered records shown