Euphorbia apios

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records111

Data sources13

Biological traits13

DNA specimens2

eDNA detections1

Sources13 archives

Databases and archives Euphorbia apios's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility111 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF111 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 30

01Narrative

Euphorbia apios is a species of plant in the family Euphorbiaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height0.2 m

Life cycle & reproduction3

Life formannual or perennial

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Growth formherb

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia apios has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences4

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPZ036521.1 ↗703 bpTurkey · 2024

ACGT

TCGAAACCTGCCCCGCAGAACGACCCGTGAACATGTTTGTAAATCGAGGGGTTGACGTAGGATTCGTCCATCGTTGATCCCTCATTGGGG …

Euphorbia apios isolate Eapios_18131 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Euphorbia apios carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records12–302n range28median30mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 303×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Papanicolaou, K. 1984. Chromosome Number Reports LXXXII. Taxon 33: 126–134.

TreeOfSex · plant — Goldblatt1979 ↗

2n 142×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74

CCDB · book-ipcn67-71 — DAMBOLDT, J., & D. PHITOS. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797.

CCDB · book-ipcn73-74 — PHITOS, D., & G. KAMARI. 1974. Zytotaxonomische Beitrage sur Flora von Kreta I. Bot. Notiser 127: 302-308.

2n 282×CCDB · ita-fl · CCDB · book-ipcn67-71

CCDB · ita-fl — CESCA G. - 1967. Osservazioni citotassonomiche su Euphorbia apios L., E. ceratocarpa Ten., E. amygdaloides L. s.l., E. characias L. s.l.. Arch. Bot. Biogeogr. Ital. , 43(12) (4): 280-291.

CCDB · book-ipcn67-71 — CESCA, G. 1967. osservazioni citotassonomiche su Euphorbia apios L., E. ceratocarpa Ten., E. amygdaloides L. s.)., E. characias L. s.). Arch. Bot. Biogeogr. Ital. 43: 280-290.

2n 121×CCDB · fl-europaea

CCDB · fl-europaea — Kozuharov &

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.876 ↗

08Occurrence & distribution

Record type111 records

Wild obs. + sensor21

Museum / vouchered90

Range

Area of Occupancy AOO400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 9≤1 km 9≤10 km 1>10 km 1

20 georeferenced · 1 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 4

6 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	57
LDlocation not on record	16
Paris, FR	5
Wlocation not on record	4
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
Tilburg, NL	1
BG-NMNHSlocation not on record	1

7 institutions · 87 of 90 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Euphorbia apios was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)