Euphorbia amygdaloides
speciesAt a glance
Occurrence records184 547
Data sources15
Biological traits41
DNA specimens28
eDNA detections17
Sources15 archives
Databases and archives Euphorbia amygdaloides's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility184 547 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics28 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Chemical compositionLOTUS · NPASS73 compounds
Occurrence & distributionGBIF184 547 records
Environmental DNA2 datasets · 4 countries17 detections
DNA & barcodingBOLD · NCBI28 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex3.5 Gbp
01Narrative
L'Euphorbe des bois ou Euphorbe faux-amandier est une plante de la famille des Euphorbiacées. Elle pousse dans les endroits ombragés, principalement en sous-bois.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology11
Leaf length max28 mm
Leaf mass13.34 mg
Leaf size316 mm²
Plant height0.368 m
⚠ sources differ — GIFT: 0.368 m · LEDA: 0.375 m · TRY: 0.18 m
Plant height generative0.21 m
Plant height max1 m
Plant height min0.2 m
Seed length2.42 mm
Seed mass3.58 mg
⚠ sources differ — TRY: 3.58 mg · LEDA: 4.15 mg · GIFT: 3.75 mg
Seed mass max4.38 mg
Seed mass min1.8 mg
Life cycle & reproduction13
Deciduousnessevergreen
Dispersal typehuman
Flowering endMay
Flowering startApr
Life formperennial
Life spanperennial
Lifespan years6 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
Reproduction asexualabsent
Seed number37.5
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest edges, hills, limestone, meadows, shrubberies
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry6
Leaf c467 mg/g
Leaf dry-matter content (LDMC)240 mg/g
⚠ sources differ — TRY: 240 mg/g · LEDA: 286 mg/g
Leaf n28.08 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)38.7 mm²/mg
⚠ sources differ — TRY: 38.7 mm²/mg · LEDA: 24.04 mm²/mg · GIFT: 24.04 mm²/mg
Other traits1
Diaspore typeseed
03Chemical composition73 compounds
Compounds documented for Euphorbia amygdaloides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Jatrophane diterpenoids24
Flavonols10
Simple phenolic acids4
Flavones3
Flavan-3-ols3
Documented compounds73 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-taxifolin | present | NPASS | |
| (1R,8S,9R,16R,18S,27S)-9-(3,4-dihydroxyphenyl)-5,8,16,21,23-pentahydroxy-2,10,17,26-tetraoxaheptacyclo[14.11.1.01,13.03,12.06,11.018,27.020,25]octacosa-3(12),4,6(11),13,20,22,24-heptaen-15-one | present | NPASS | |
| (E)-N-(2-hydroxyethyl)-3-[(S)-methylsulfinyl]prop-2-enamide | present | NPASS | |
| (S)-Naringenin | present | NPASS | |
| 2'-Methylisoliquiritigenin | present | NPASS | |
| 2-beta-d-Glucopyranosyloxy-5-butoxyphenylacetic acid | present | NPASS | |
| 2-Hydroxy-5-butoxyphenylacetic acid | present | NPASS | |
| 5-hydroxy-2-[5-hydroxy-4-methoxy-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-3,7-dimethoxychromen-4-one | present | NPASS | |
| 5-Hydroxy-3,7,4'-trimethoxyflavone | present | NPASS | |
| 7,4'-Dihydroxyflavone | present | NPASS |
05DNA & barcoding28 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia amygdaloides has left across the world's sequence archives.
At a glance
DNA specimens28
Marker genes5
GenBank sequences10
eDNA detections17
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGGATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGTGTCACTCAAT …
Euphorbia amygdaloides voucher EDNA21-0060738 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★ITS10★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Euphorbia amygdaloides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 462 120 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Euphorbia amygdaloides3.46 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy2× diploid · measured
Chromosome records18–402n range20median20mode49records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2039×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +11
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — CESCA G. - 1967. Osservazioni citotassonomiche su Euphorbia apios L., E. ceratocarpa Ten., E. amygdaloides L. s.l., E. characias L. s.l.. Arch. Bot. Biogeogr. Ital. , 43(12) (4): 280-291.
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · brit-fl — Bauer, Z. Acta Biol. Cracov., Ser. Bot. 11: 77-85 (1968)
CCDB · iber-fl — Contribucin al estudio cariolgico del gnero Euphorbia L., subgn. Esula Pers. Juan, R. & J. Pastor.Bol. Soc. Brot. ser. 266: 41-54(1993).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XI. Euphorbiaceae Queirs, M.Bol. Soc. Brot. ser. 249: 143-161(1975).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3117
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · mediterranean
CCDB · ipcn-api-dl — Strid, A. 1983. In IOPB chromosome number reports LXXVIII. Taxon 32: 138–140.
CCDB · ipcn-api-dl — Verlaque, R., C. Vignal & M. Seidenbinder. 1987. Recherches cytotaxonomiques sur la spéciation en région Méditerrannéene II: espèces dysploides. Biol.-Ecol. Medit. 10: 291–313.
CCDB · ipcn-api-dl — Murin, A. 1976. In: Index of chromosome numbers of Slovian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Javurkova, V. 1981. In Chromosome number reports LXXIII. Taxon 30: 856–857.
CCDB · ipcn-api-dl — Queiros, M. 1975a. Contribuicao para o conhecimento citotaxonomico das Spermatophyta de Portugal. XI. Euphorbiaceae. Bol. Soc. Brot., sér. 2 49: 143–161.
CCDB · ipcn-api-dl — HURUSAWA, I. & S. SHIMOYAMA. 1976. Die Mannigfaltigkeit der Chromosomenzahl bei der Gattung Euphorbia. Beitr. Biol. Pflanzen 52: 255–266.
CCDB · ipcn-api-dl — Iyer, Y. K. 1991. Mediterranean chromosome number reports 1 (30--37). Fl. Medit. 1: 238–240.
CCDB · ipcn-api-dl — Murin, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · book-ipcn67-71 — BAUER, z. 1968. Karyological studies in the genus Euphorbia L. I. Euphorbia amygdaloides L. Acta Biol. Cracov. Ser. Bot. 11: 77-.86.
CCDB · book-ipcn67-71 — CESCA, G. 1967. osservazioni citotassonomiche su Euphorbia apios L., E. ceratocarpa Ten., E. amygdaloides L. s.)., E. characias L. s.). Arch. Bot. Biogeogr. Ital. 43: 280-290.
CCDB · kew — Temsch EM, Temsch W, Ehrendorfer-Schratt L, Greilhuber J. 2010. Heavy metal pollution, selection, and genome size: The species of the Žerjav study revisited with flow cytometry. Journal of Botany 2010: Article ID 596542, 11 pages.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1983a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVIII]. Taxon 32(1): 138-140.
CCDB · CromoCat 2015 — Bauer, Z. (1968). Karyological studies in the genus Euphorbia L. I. Euphorbia amigdaloides L. Acta Biol. Cracov., Ser. Bot. 11: 77-86.
CCDB · CromoCat 2015 — Bauer, Z. (1971). Karyological studies on the genus Euphorbia L. II. Acta Biol. Cracov., Ser. Bot. 14: 159-178.
CCDB · CromoCat 2015 — Cesca, G. (1967). Osservazioni citotassonomiche su Euphorbia apios L., E. ceratocarpa Ten., E. amygdaloides L. s. l., E. characias L. s. l Arch. Bot. Biogeogr. Ital. 43: 280-290.
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Hindakova, M. (1976). Index of chromosome numbers of Slovakian flora. (Part 5). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1-18.
CCDB · CromoCat 2015 — Hurusawa, I. & Shimoyama, S. (1976). Die Mannigfaltigkeit der Chromosomenzahl bei der Gattung Euphorbia. Beitr. Biol. Pflanzen 52: 255-266.
CCDB · CromoCat 2015 — Javurková, V. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 856-857.
CCDB · CromoCat 2015 — Queirós, M. (1975b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XI. Euphorbiaceae. Bol. Soc. Brot. 49: 143-161.
CCDB · CromoCat 2015 — Verlaque, R., C. Vignal & M. Seidenbinder. (1987e). Recherches cytotaxonomiques sur la spéciation en région Méditerrannéene II: espèces dysploides. Biol. & Écol. Médit. 10: 291-313.
TreeOfSex · plant — Goldblatt1979 ↗
2n 189×GoaT · Tree of Sex Database · CCDB · fl-europaea · CCDB · ipcn-api-dl +2
GoaT · Tree of Sex Database — ↗
CCDB · fl-europaea — D'Amato, 1939
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · book-atlas-flowering-plants — Eur., Cauc., Alg.
CCDB · CromoCat 2015 — D'Amato, F. (1939). Ricerche embriologiche e cariologiche sul genere Euphorbia. Nuovo Giorn. Bot. Ital. 46: 470-508.
CCDB · CromoCat 2015 — Pashuk, K. T. (1987). Chromosome number in species of subalpine belt of Chernogora (Ukrainian Carpathians). Bot. Žurn. 72(8): 1069-1074.
CCDB · CromoCat 2015 — Perry, B. A. (1943). Chromosome numbers and phylogenetic relationships in the Euphorbiaceae. Amer. J. Bot. 30: 527-543.
CCDB · CromoCat 2015 — Pólya, L. (1950). Magyarországi növényfajok kromoszómaszámai. II. Ann. Biol. Univ. Decebren. 1: 46-56.
CCDB · CromoCat 2015 — Shimoyama, S. (1959). Cytological studies in the genus Euphorbia, III. Ann. Rept. Natl. Inst. Genet. (Japan) 8: 49.
2n 401×CCDB · nw-europe-fl
n 93×CCDB · ita-fl · CCDB · CromoCat 2015
CCDB · ita-fl — D'AMATO F. - 1939. Ricerche embriologiche e cariologiche sul genere "Euphorbia".. N. Giorn. Bot. Ital., n.s. , 46(3): 470-509.
CCDB · CromoCat 2015 — D'Amato, F. (1939). Ricerche embriologiche e cariologiche sul genere Euphorbia. Nuovo Giorn. Bot. Ital. 46: 470-508.
n 103×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — BAUER, z. 1968. Karyological studies in the genus Euphorbia L. I. Euphorbia amygdaloides L. Acta Biol. Cracov. Ser. Bot. 11: 77-.86.
CCDB · CromoCat 2015 — Bauer, Z. (1968). Karyological studies in the genus Euphorbia L. I. Euphorbia amigdaloides L. Acta Biol. Cracov., Ser. Bot. 11: 77-86.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.576 ↗
08Occurrence & distribution
Record type184 547 records
Wild obs. + sensor176 250
Museum / vouchered4 249
Cultivated / captive83
Other3 965
Origin
Native5 988
Introduced545
Range
Area of Occupancy AOO183 116 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy33% within 1 km
≤100 m 24 508≤1 km 23 601≤10 km 94 411>10 km 1 856
144 376 georeferenced · 31 874 without coordinates
Open the mapobservation + sensor176 250
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 196≤1 km 850≤10 km 1 765>10 km 37
2 848 georeferenced · 1 401 without coordinates
Open the institutions mapphysical evidence4 249
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 82 without coordinates
Open the mapnot free-living83
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions63 of 128 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 818 |
| BIO-UNIPIlocation not on record | 391 |
| BRNUlocation not on record | 214 |
| MeiseBGlocation not on record | 177 |
| Salzburg, AT | 147 |
| Berlin, DE | 101 |
| Moscow State Universitylocation not on record | 97 |
| GJOlocation not on record | 95 |
| Paris, FR | 70 |
| Barcelona, ES | 61 |
| Adam Mickiewicz University in Poznańlocation not on record | 53 |
| MAlocation not on record | 53 |
| Entomological Society of Latvialocation not on record | 50 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 50 |
| Provincia di Livornolocation not on record | 34 |
| BDBClocation not on record | 34 |
| Wlocation not on record | 33 |
| València, ES | 30 |
| South Kensington, GB | 29 |
| LDlocation not on record | 29 |
| Chicago, US | 28 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 26 |
| Vitoria, ES | 25 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 22 |
| San Sebastián, ES | 22 |
| BFLlocation not on record | 22 |
| Bern, CH | 21 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 21 |
| BClocation not on record | 17 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 17 |
| SZUlocation not on record | 14 |
| College of the Atlantic, Museumlocation not on record | 13 |
| Salamanca, ES | 13 |
| Porrentruy, CH | 10 |
| PRClocation not on record | 10 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 10 |
| Oskarshamn, SE | 9 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 9 |
| Christchurch, NZ | 8 |
| Karlsruhe, DE | 8 |
| Winterthur, CH | 7 |
| Uniwersytet Śląski w Katowicachlocation not on record | 7 |
| GZUlocation not on record | 6 |
| Görlitz, DE | 6 |
| Frauenfeld, CH | 5 |
| H-Schuhwlocation not on record | 5 |
| Zürich, CH | 5 |
| Dresden, DE | 5 |
| Gijón, ES | 4 |
| Natural History Museum Rotterdamlocation not on record | 4 |
| Durham, US | 4 |
| Madrid, ES | 4 |
| No collectionlocation not on record | 4 |
| Zürich, CH | 4 |
| Hobart, AU | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Sion, CH | 3 |
| Podgorica, ME | 3 |
| Sant Julià de Lòria, AD | 3 |
| Kew, GB | 3 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 3 |
| Tilburg, NL | 3 |
| Mlocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Olocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Bourges, FR | 3 |
| CJBGlocation not on record | 3 |
| OLAlocation not on record | 3 |
| Fort Worth, US | 2 |
| Frankfurt am Main | 2 |
| DBF-NHMDlocation not on record | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| ULBF-AGRlocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Dekalb, US | 2 |
| Wellington, NZ | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| H-AkrKGlocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| Taipei, TW | 2 |
| Jaén, ES | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| UGentlocation not on record | 2 |
| Granada, ES | 2 |
| Ann Arbor, US | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| Beijing, CN | 2 |
| Pamplona, ES | 2 |
| MHNAIXlocation not on record | 1 |
| Glarus, CH | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Monastir, TN | 1 |
| Davenport, US | 1 |
| Xiamen, CN | 1 |
| Bangkok, TH | 1 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 |
| Portland, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| UniKSlocation not on record | 1 |
| Helsinki, FI | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Banyoles, ES | 1 |
| Brussel, BE | 1 |
| Riverside, US | 1 |
| Saint Louis, US | 1 |
| University of Alberta Museumslocation not on record | 1 |
| San Diego, US | 1 |
| Québec, CA | 1 |
| Macomb, US | 1 |
| Uppsala, SE | 1 |
| Tartu, EE | 1 |
| Auckland, NZ | 1 |
| Voronezh State Universitylocation not on record | 1 |
| Badajoz, ES | 1 |
| ISAlocation not on record | 1 |
| Bronx, US | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| CJBNlocation not on record | 1 |
| LfUlocation not on record | 1 |
| Stockholm, SE | 1 |
| EL PASO, US | 1 |
| Bergen, NO | 1 |
| UNINE:NEUlocation not on record | 1 |
128 institutions · 4 090 of 4 249 vouchered records shown · 153 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA17 detections
Where the DNA of Euphorbia amygdaloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys2
Countries4
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map4 countries0
edge of wood
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.1 °C 3.00–15.2
Seasonal swing summer↔winter16.8 °C
Max temp (day)13.8 °C 8.60–19.3
Min temp (night)6.40 °C -3.00–10.7
Precipitation74.2 mm/mo 53.3–265
Air humidity59.8 % 56.7–61.8
Moisture balance-22.5 mm/mo -49.4–218
Vapour deficit485 Pa 335–703
Wind speed3.00 m/s 1.20–4.30
Cloud cover41.7 % 38.4–48.1
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.