Euphorbia acanthothamnos

Heldr. & Sartori ex Boiss. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Euphorbia

At a glance

Occurrence records620

Data sources12

Biological traits19

DNA specimens4

eDNA detections4

Sources12 archives

Databases and archives Euphorbia acanthothamnos's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility620 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF620 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 14

01Narrative

Euphorbia acanthothamnos, is a species of flowering plant, belonging to the family Euphorbiaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height0.293 m

Life cycle & reproduction5

Deciduousnessevergreen

Life formsubshrub

Life spanperennial

Lifespan years30 years

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Growth formshrub

Mycorrhiza typenon-ectomycorrhizal

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)387 mg/g

Leaf n21.5 mg/g

Leaf p1.4 mg/g

Specific leaf area (SLA)19.37 mm²/mg

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphorbia acanthothamnos has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSHQ900573.1 ↗632 bpGreece

ACGT

TCGAAACCTGCTCCGCAGAACGACCCGTGAACATGTTTGTAAATCGAGGGGTTGACGCGGGATTCATCCATCGTTGATCCCTCATTGGGG …

Euphorbia acanthothamnos voucher Riina 1562 (MICH) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS9★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Euphorbia acanthothamnos carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 146×GoaT · Tree of Sex Database · CCDB · ita-fl · CCDB · ipcn-api-dl +2

GoaT · Tree of Sex Database — ↗

CCDB · ita-fl — CESCA G. - 1969. Ricerche citotassonomiche nelle Euphorbiaceae: Euphorbia spinosa L., E. bivonae Steud., E. melitensis Parl., E. acanthothamnos Heldr. et Sart.. Giorn. Bot. Ital. , 103(3): 205-263.

CCDB · ita-fl — CESCA G. - 1966. Cytological and embriological studies in the genus Euphorbia.. Giorn. Bot. Ital. , 73(4-6): 276-279.

CCDB · ipcn-api-dl — Phitos, D., G. Kamari & K. Athanasiou. 1989. Chromosome numbers in some species of the Greek flora. Bot. Chron. (Patras) 9: 41–47.

CCDB · book-ipcn67-71 — CESCA, G. 1969. Ricerche cititassonomiche nelle Euphorbiaceae: Euphorbis spinosa L., E. bivonae Steud., E. melitensis Parl., ~ acanthothamnos Heldr. et Sart. Giron.-Bot. Ital. 103: 205-263.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.984 ↗

08Occurrence & distribution

Record type620 records

Wild obs. + sensor526

Museum / vouchered91

Cultivated / captive1

Other2

Origin

Native1

Range

Area of Occupancy AOO1 468 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 284≤1 km 89≤10 km 16>10 km 12

401 georeferenced · 125 without coordinates

Open the mapobservation + sensor526

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 8≤1 km 3≤10 km 3

14 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence91

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	48
Berlin, DE	10
Barcelona, ES	5
Provincia di Livornolocation not on record	4
Görlitz, DE	2
Ann Arbor, US	2
València, ES	2
Salzburg, AT	1
CJBGlocation not on record	1
MAlocation not on record	1
Davis, US	1
Xiamen, CN	1
GJOlocation not on record	1
Dresden, DE	1
BRNUlocation not on record	1
Wlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

17 institutions · 83 of 91 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Euphorbia acanthothamnos was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 17.0–17.0

Seasonal swing summer↔winter16.2 °C

Max temp (day)18.5 °C

Min temp (night)14.9 °C

Precipitation55.2 mm/mo

Air humidity62.8 %

Moisture balance-51.6 mm/mo

Vapour deficit758 Pa

Wind speed3.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)