Euphonia anneae

Cassin, 1865 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Fringillidae/Euphonia

At a glance

Occurrence records41 718

Data sources9

Biological traits20

DNA specimens7

eDNA detections7

Sources9 archives

Databases and archives Euphonia anneae's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 718 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF41 718 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

The tawny-capped euphonia (Euphonia anneae) is a species of bird in the family Fringillidae. It is found in Colombia, Costa Rica, and Panama. Its natural habitats are subtropical or tropical moist lowland forest, subtropical or tropical moist montane forest, and heavily degraded former forest. Illustration of a male and female

No narrative description available for this taxon yet.

02Traits & measurements

SourcesEltonTraitsAVONETAmnioteDB

Size & morphology11

Beak depth4.9 mm

Beak length (culmen)11.3 mm

Beak length (nares)6.6 mm

Beak width4.5 mm

Body mass15.15 g

Hand-wing index20.2

Kipp's distance12.9 mm

Secondary length51 mm

Tail length36.2 mm

Tarsus length15.7 mm

Wing length63.9 mm

Diet & foraging5

Fruit100 %

Midhigh70 %

Trophic levelherbivore

Trophic nicheFrugivore

Understory30 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size20 147 km²

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphonia anneae has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

22Tmostly conserved

163Avariable

265Cmostly conserved

451Amostly conserved

511Tvariable

529Amostly conserved

CCTGTACCTAATTTTCGGTGCTTGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCAGGGGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes3

BIN1

Most divergent pair0.77%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euphonia xanthogastersame genus6.6%Euphonia gouldisame genus8.9%Euphonia mesochrysasame genus8.9%Euphonia chloroticasame genus9.0%Euphonia luteicapillasame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type41 718 records

Wild obs. + sensor41 663

Museum / vouchered55

Origin

Native7

Range

Area of Occupancy AOO3 464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 271≤1 km 143≤10 km 35>10 km 11

460 georeferenced · 41 203 without coordinates

Open the mapobservation + sensor41 663

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 1≤10 km 15>10 km 1

17 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Seattle, US	26
Moore Laboratory of Zoology, Occidental Collegelocation not on record	9
Louisiana State University, Museum of Zoologylocation not on record	6
Washington, US	5
Ithaca, US	2
Denver, US	1
Cambridge, US	1
Ann Arbor, US	1
Edmonton, CA	1

9 institutions · 52 of 55 vouchered records shown · 3 without an institution code

09Environmental DNA7 detections

Where the DNA of Euphonia anneae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 22.0–24.2

Seasonal swing summer↔winter1.00 °C

Max temp (day)27.0 °C 25.2–27.9

Min temp (night)20.2 °C 19.6–21.3

Precipitation37.9 mm/mo 33.5–112

Air humidity72.9 % 67.9–74.6

Moisture balance-109 mm/mo -118–-20.5

Vapour deficit728 Pa 723–946

Wind speed3.00 m/s 2.50–3.80

Cloud cover12.5 % 12.2–13.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euphonia anneae

At a glance

Sources9 archives

Size & morphology11

Diet & foraging5

Habitat & environment4

At a glance

Record type41 718 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type41 718 records