Euphilotes enoptes

(Boisduval, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Euphilotes

At a glance

Occurrence records782

Data sources7

Biological traits0

DNA specimens44

eDNA detections3

Sources7 archives

Databases and archives Euphilotes enoptes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility782 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF782 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD44 specimens

01Narrative

Euphilotes enoptes, Dutchman's Peak, Oregon Smith's blue butterfly, Euphilotes enoptes smithi, is an subspecies of butterfly in the family Lycaenidae. This federally listed endangered subspecies of Euphilotes enoptes occurs in fragmented populations along the Central Coast of California, primarily associated with sand dune habitat in one case with a dune-based Maritime Coast Range Ponderosa Pine forest in the Carbonera Creek watershed in Santa Cruz County.Environmental Impact Report for the Scotts Valley Redeveopment Area, Earth Metrics Inc., Report no. 7888, State of California Clearinghouse (1990) The range of E. e. smithi is from Monterey Bay south to Punta Gorda. Over half of the original habitat of E. e. smithi has been destroyed by human overpopulation, coastal highway development and trampling of habitat, and invasive plants.Black, H.D and D.M. Vaughn, Species pro

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euphilotes enoptes has left across the world's sequence archives.

At a glance

DNA specimens44

BINs1

Marker genes2

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

85Amostly conserved

118Tvariable

223Tmostly conserved

235Tvariable

304Cmostly conserved

368Gmostly conserved

475Tmostly conserved

477Amostly conserved

499Cmostly conserved

529Amostly conserved

530Cmostly conserved

562Avariable

578Tmostly conserved

613Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGAATTTTAATTCGTATAGAATTAGGAACTCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.68%

Haplotypes14

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euphilotes ritasame genus2.1%Euphilotes speciosasame genus3.0%Euphilotes leonasame genus3.2%Euphilotes spaldingisame genus3.2%Euphilotes ellisiisame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type782 records

Wild obs. + sensor521

Museum / vouchered261

Range

Area of Occupancy AOO1 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 188≤1 km 109≤10 km 39>10 km 18

354 georeferenced · 167 without coordinates

Open the mapobservation + sensor521

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 1≤1 km 97≤10 km 129>10 km 14

241 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence261

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	180
Philadelphia, US	14
San Diego, US	12
WSUClocation not on record	11
Cleveland Museum of Natural History, OH (CLEV)location not on record	10
New Haven, US	8
Denver, US	5
Georgia Museum of Natural Historylocation not on record	3
OSUClocation not on record	2
Natural History Museum of Utahlocation not on record	1
Colorado State Universitylocation not on record	1
WWUlocation not on record	1

12 institutions · 248 of 261 vouchered records shown · 12 without an institution code

09Environmental DNA3 detections

Where the DNA of Euphilotes enoptes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 12.8–15.5

Seasonal swing summer↔winter17.9 °C

Max temp (day)20.5 °C 18.8–22.1

Min temp (night)9.30 °C 8.50–10.1

Precipitation49.1 mm/mo 24.6–73.5

Air humidity57.9 % 57.5–58.4

Moisture balance-77.2 mm/mo -108–-46.1

Vapour deficit740 Pa 734–745

Wind speed4.10 m/s 2.80–5.50

Cloud cover42.7 % 37.9–47.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)