Eupatorium tashiroi

Hayata · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Eupatorium

At a glance

Occurrence records557

Data sources8

Biological traits14

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Eupatorium tashiroi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility557 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources14 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF557 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Eupatorium tashiroi is a plant species in the family Asteraceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFT

Size & morphology10

Fruit length2.5 mm

Fruit length max2.5 mm

Fruit length min2.5 mm

Leaf length75 mm

Leaf length max90 mm

Leaf length min60 mm

Leaf width30 mm

Leaf width max35 mm

Leaf width min25 mm

Plant height2 m

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climberself-supporting

Growth formshrub

Woodinesswoody

03Chemical composition2 compounds

Compounds documented for Eupatorium tashiroi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Bisabolane sesquiterpenoids $ Miscellaneous meroterpenoids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(2R)-2-(2-hydroxy-4-methylphenyl)propane-1,2-diol		present	LOTUS
(2S)-2-(2-hydroxy-4-methylphenyl)propane-1,2-diol		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eupatorium tashiroi has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAB032037.1 ↗666 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGGATGGCAAAACAACCCGTGAACGTGTATCAACAATATGGCTTGGCGGG …

Eupatorium tashiroi genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eupatorium tashiroi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1978. Chromosome numbers in Taiwan Compositae. Bot. Bull. Acad. Sin. 19: 53–66.

CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1977. In IOPB chromosome number reports LVIII. Taxon 26: 557–565.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type557 records

Wild obs. + sensor389

Museum / vouchered168

Range

Area of Occupancy AOO1 292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 182≤1 km 41≤10 km 24>10 km 8

255 georeferenced · 134 without coordinates

Open the mapobservation + sensor389

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 168 records without

Open the institutions mapphysical evidence168

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	117
Taipei, TW	28
Taipei, TW	13
Beijing, CN	6
CASlocation not on record	3
Kunming, CN	1

6 institutions · 168 of 168 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)