Eupatorium mikanioides

Chapm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Eupatorium

At a glance

Occurrence records320

Data sources11

Biological traits11

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Eupatorium mikanioides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility320 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Chemical compositionLOTUS · NPASS24 compounds

Occurrence & distributionGBIF320 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Eupatorium mikanioides, commonly called semaphore thoroughwort, is a herbaceous perennial plant in the family Asteraceae found only in the US state of Florida.Biota of North America Program 2014 county distribution map Like other members of the genus Eupatorium, it produces large numbers of small white flower heads, each head with 5 disc florets but no ray florets. It grows a half meter to one meter tall. It grows in wet to moist areas, and is salt-tolerant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology2

Leaf size1 294 mm²

Plant height0.259 m

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)203 mg/g

Specific leaf area (SLA)22.22 mm²/mg

03Chemical composition24 compounds

Compounds documented for Eupatorium mikanioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Germacrane sesquiterpenoids15

Flavones6

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3S,4S,5R,6R)-6-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxochromen-7-yl]oxy-3,4,5-trihydroxyoxane-2-carboxylic acid	present	NPASS
(3aS,4R,6E,8R,10E,11aR)-4,8-dihydroxy-6,10-dimethyl-3-methylidene-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-2-one	present	LOTUS
(8-Hydroxy-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl) 2,3-dimethyloxirane-2-carboxylate	present	LOTUS
(9-Hydroxy-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl) 2-(hydroxymethyl)but-2-enoate	present	LOTUS
2-(3,4-dihydroxyphenyl)-5-hydroxy-7-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	NPASS
2-Hydroxyeupatolide	present	LOTUS
7-O-Beta-D-Glucopyranoside	present	NPASS
[(3aR,4R,6E,8R,10E,11aR)-8-hydroxy-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (3S)-3-hydroxy-2-methylidenebutanoate	present	LOTUS
[(3aR,4R,6E,8R,10E,11aR)-8-hydroxy-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (Z)-2-(hydroxymethyl)but-2-enoate	present	LOTUS
[(3aR,4R,6E,8S,10E,11aS)-8-hydroxy-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (2R,3R)-2,3-dimethyloxirane-2-carboxylate	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eupatorium mikanioides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF177858.1 ↗213 bpUSA

ACGT

ATCACGTCGCCCACATCAAACATCCATGATGCATGTGGGCGGAGNCTGGTCTCCTGTGCCCGTGGCGCGGTTGGCCCAAATAAGAGTCCG …

Eupatorium mikanioides specimen-voucher G.J. Schmidt #fb1997-05 internal transcribed spacer 2 ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eupatorium mikanioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · eflora

CCDB · eflora

n 101×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sullivan. 1976. Diploidy, polyploidy, and agamospermy among species of Eupatorium (Compositae). Canad. J. Bot. 54(24): 2907–2917.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type320 records

Wild obs. + sensor205

Museum / vouchered115

Range

Area of Occupancy AOO844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 131≤1 km 23≤10 km 5>10 km 18

177 georeferenced · 28 without coordinates

Open the mapobservation + sensor205

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤1 km 1≤10 km 12>10 km 22

35 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence115

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	41
Tampa, US	27
Miami, US	21
Chapel Hill, US	11
Bronx, US	3
Bangkok, TH	3
Bloomington, US	3
Tall Timbers Research Stationlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Mississippi State, US	1
Columbia, US	1
Tuscaloosa, US	1

12 institutions · 115 of 115 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Eupatorium mikanioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)