Eupatorium leucolepis

(DC.) Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Eupatorium

At a glance

Occurrence records712

Data sources12

Biological traits10

DNA specimens3

eDNA detections3

Sources12 archives

Databases and archives Eupatorium leucolepis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility712 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS17 compounds

Occurrence & distributionGBIF712 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 60

01Narrative

Eupatorium leucolepis, commonly called justiceweed or white-bracted thoroughwort, is a herbaceous perennial plant in the family Asteraceae native from the eastern coastal United States, from New York to eastern Texas, with scattered populations inland as far as Kentucky and West Virginia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass0.307 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition17 compounds

Compounds documented for Eupatorium leucolepis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavones11

Colensane and Clerodane diterpenoids2

Flavanones1

Documented compounds17 total

Tissue Source Quantified only

Compound	Amount	Source
3-[[(4aR,5S,6R,8aR)-5-[2-[(3R,5R)-5-methoxyoxolan-3-yl]ethyl]-5,6,8a-trimethyl-3,4,4a,6,7,8-hexahydronaphthalen-1-yl]methoxy]-3-oxopropanoic acid	present	NPASS
3-O-[[(4aR,5R,6S,7R,8aR)-5-[(3R)-5-acetyloxy-3-(acetyloxymethyl)pentyl]-7-hydroxy-5,6,8a-trimethyl-3,4,4a,6,7,8-hexahydronaphthalen-1-yl]methyl] 1-O-methyl propanedioate	present	NPASS
4'-Demethylnobiletin	present	LOTUS
4'-Hydroxy-5,6,7,8,3',5'-hexamethoxyflavone	present	LOTUS
5,6,7,8,3'-Pentamethoxy-4',5'-methylenedioxyflavone	present	LOTUS
6-Methylscutellarein	present	NPASS
Apigenin	present	NPASS
Cirsimaritin	present	NPASS
Eupatorin	present	NPASS
Genkwanin	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eupatorium leucolepis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF177857.1 ↗213 bpUSA

ACGT

ATCACGTCGCCCACATCAAACATCCATGATGTATGTGGGCGGAGACTGGTCTCCTGTGCCCATGGTGCGGTTGGCCCAAATACGAGTCCG …

Eupatorium leucolepis specimen-voucher G.J. Schmidt #fb1997-03 internal transcribed spacer 2 ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eupatorium leucolepis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 101×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Sullivan 1976

n 301×CCDB · book-ipcn65

CCDB · book-ipcn65 — DeLisle 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type712 records

Wild obs. + sensor242

Museum / vouchered470

Range

Area of Occupancy AOO2 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 120≤1 km 14≤10 km 7>10 km 72

213 georeferenced · 29 without coordinates

Open the mapobservation + sensor242

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 18≤1 km 52≤10 km 131>10 km 48

249 georeferenced · 221 without coordinates

Open the institutions mapphysical evidence470

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions34 of 48 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	89
Jena Microbial Resource Collectionlocation not on record	43
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	43
Bronx, US	43
Bangkok, TH	33
Jackson, US	23
US	17
Valdosta State Universitylocation not on record	14
Chongqing Museumlocation not on record	14
Columbia, US	12
Chapel Hill, US	12
Tampa, US	9
University of South Carolina Salkehatchielocation not on record	8
Mississippi State, US	7
Staten Island, US	7
Williamsburg, US	7
Austin, US	7
University of Stellenboschlocation not on record	7
Tall Timbers Research Stationlocation not on record	6
Miami, US	5
Tuscaloosa, US	5
University of Southern Mississippilocation not on record	5
Bloomington, US	5
Weymouth Woods Sandhills Nature Preservelocation not on record	4
Knoxville, US	4
GAlocation not on record	3
Washington, US	3
Clemson, US	3
Fort Worth, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
College Park, US	2
Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record	2
Saint Louis, US	2
AUAlocation not on record	2
Norfolk, US	2
Denver, US	1
University of New Hampshirelocation not on record	1
Minia, EG	1
Wuzhou, CN	1
GB	1
EL PASO, US	1
New Brunswick, US	1
Millersville, US	1
Northridge, US	1
Montréal, CA	1
Flagstaff, US	1
Fairfax, US	1
San Angelo, US	1

48 institutions · 465 of 470 vouchered records shown · 5 without an institution code

09Environmental DNA3 detections

Where the DNA of Eupatorium leucolepis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)