Eupatorium leptophyllum

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Eupatorium

At a glance

Occurrence records771

Data sources11

Biological traits11

DNA specimens1

eDNA detections0

Sources11 archives

Databases and archives Eupatorium leptophyllum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility771 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Chemical compositionLOTUS · NPASS2 compounds

Occurrence & distributionGBIF771 records

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Eupatorium leptophyllum, commonly called false fennel, is a herbaceous perennial plant in the family Asteraceae native to the southeastern United States from Mississippi to the Carolinas.Biota of North America Program 2014 county distribution map Like other members of the genus Eupatorium, it is about one to two meters (40-80 inches) tall and has inflorescences containing a large number of tiny white flower heads, each with 5 disc florets but no ray florets. E. leptophyllum grows in wet areas and can grow in shallow water, often at the edges of ponds.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology2

Leaf size372 mm²

Plant height0.219 m

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)154 mg/g

Specific leaf area (SLA)24.56 mm²/mg

03Chemical composition2 compounds

Compounds documented for Eupatorium leptophyllum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavonols1

Lupane triterpenoids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
2-(3,4-dihydroxyphenyl)-5-hydroxy-7-methoxy-3-[(2R,3S,4R,5S,6S)-3,4,5-trihydroxy-6-[[(2S,3S,4S,5S,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one		present	LOTUS
Lupenone		present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eupatorium leptophyllum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV248102.1 ↗634 bpUSA · 1974

ACGT

TCGAACCCTGGATGGTAAAACAACCCGTGAACGTGTATCAACAAGATGGCTTGGCGGGTACTTGATGCTTCTTGTTTCAATCCCCGTGAA …

Eupatorium leptophyllum voucher Godfrey 74111, TENN internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eupatorium leptophyllum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type771 records

Wild obs. + sensor500

Museum / vouchered271

Range

Area of Occupancy AOO1 724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 336≤1 km 36≤10 km 10>10 km 35

417 georeferenced · 83 without coordinates

Open the mapobservation + sensor500

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 4≤1 km 4≤10 km 2>10 km 36

46 georeferenced · 225 without coordinates

Open the institutions mapphysical evidence271

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	120
Tampa, US	53
Miami, US	35
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	11
Valdosta State Universitylocation not on record	4
Tall Timbers Research Stationlocation not on record	4
Columbia, US	4
Bangkok, TH	4
Jackson, US	3
University of Stellenboschlocation not on record	3
Tuscaloosa, US	3
Flagstaff, US	3
GAlocation not on record	3
LDlocation not on record	2
Bronx, US	2
Mississippi State, US	2
Claremont, US	2
Clemson, US	1
Tempe, US	1
McWane Science Centerlocation not on record	1
US	1
Saint Louis, US	1
Montréal, CA	1
EL PASO, US	1
Baltimore, US	1
Knoxville, US	1
Florida Museum of Natural Historylocation not on record	1
Philadelphia, US	1

28 institutions · 269 of 271 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)