Eupatorium fortunei

Turcz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Eupatorium

At a glance

Occurrence records382

Data sources12

Biological traits19

DNA specimens17

eDNA detections17

Sources12 archives

Databases and archives Eupatorium fortunei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility382 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources19 traits

Chemical compositionLOTUS · NPASS149 compounds

Occurrence & distributionGBIF382 records

Environmental DNA1 datasets · 0 countries17 detections

DNA & barcodingBOLD · NCBI17 specimens

Genome at a glanceCCDB3.9 Gbp

01Narrative

Eupatorium fortunei is a plant species in the family Asteraceae native from Asia where it is rare in the wild but commonly cultivated. The white to reddish colored flowers and herbage smell like lavender when crushed. In China the plants are used to make fragrant oils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology15

Fruit length3.5 mm

Fruit length max4 mm

Fruit length min3 mm

Leaf length90 mm

Leaf length max120 mm

Leaf length min60 mm

Leaf width35 mm

Leaf width max45 mm

Leaf width min25 mm

Plant height0.7 m

Plant height max1 m

Plant height min0.4 m

Seed mass0.48 mg

Seed mass max0.48 mg

Seed mass min0.48 mg

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climberself-supporting

Growth formherb

Woodinessnon-woody

03Chemical composition149 compounds

Compounds documented for Eupatorium fortunei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Bisabolane sesquiterpenoids27

Menthane monoterpenoids21

Ursane and Taraxastane triterpenoids8

Acyclic monoterpenoids8

Eudesmane sesquiterpenoids6

Documented compounds149 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-alpha-Pinene	present	NPASS
(-)-Camphene	present	NPASS
(-)-Caryophyllene	present	LOTUS
(-)-Linalool	present	NPASS
(1-Hydroxy-2,3,5,7a-tetrahydro-1H-pyrrolizin-7-yl)methyl 2-hydroxy-2-(1-hydroxyethyl)-3-methylbutanoate	present	LOTUS
(1R)-1-hydroxy-1-(2-hydroxy-4-methylphenyl)propan-2-one	present	LOTUS
(1R,2R,4aR,5R,8aR)-4a-methyl-8-methylidene-2-propan-2-yl-1,2,3,4,5,6,7,8a-octahydronaphthalene-1,5-diol	present	LOTUS
(1S,2R,3R,4R,5S)-2-methyl-5-propan-2-ylcyclohexane-1,2,3,4-tetrol	present	LOTUS
(24R)-9,19-cycloart-25-ene-3beta,24-diol	present	LOTUS
(2R)-2-(2-hydroxy-4-methylphenyl)propane-1,2-diol	present	LOTUS

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eupatorium fortunei has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes4

GenBank sequences10

eDNA detections17

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPV248108.1 ↗637 bpViet Nam · 2012

ACGT

TCGAACCCTGGATGGCAAAACAACCCGTGAACGTGTATCAACAATACGGCTTGGCGGGTACTGACGCTTCTTGTTTCAATGCCCGTGAAG …

Eupatorium fortunei voucher Floden s.n., TENN internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eupatorium fortunei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 882 660 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Eupatorium fortunei3.88 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×CCDB · eflora · CCDB · Cave1956

CCDB · eflora

CCDB · Cave1956 — Huziwara b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type382 records

Wild obs. + sensor4

Museum / vouchered377

Other1

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 376 without coordinates

Open the institutions mapphysical evidence377

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chengdu, CN	75
Beijing, CN	44
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	34
Guangzhou, CN	32
Wuhan, CN	29
Guilin, CN	25
Sanda, JP	14
Central China Normal Universitylocation not on record	12
FJIDClocation not on record	11
Kunming, CN	11
WNNUlocation not on record	9
Nanchong, CN	8
Chengdu, CN	7
JGSlocation not on record	4
Kew, GB	4
Hunan Hupingshan National Nature Reservelocation not on record	4
Awka, NG	3
Chengdu, CN	3
Strecker Museum, Baylor Universitylocation not on record	3
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	3
Nanjing, CN	3
Central China Agricultural Universitylocation not on record	2
Guiyang, CN	2
SXTCMlocation not on record	2
Taipei, TW	2
SCAUlocation not on record	2
Zhuzhou, CN	2
Wuhan, CN	2
Saint Louis, US	2
武陵山动植物研究所location not on record	2
Changsha, CN	2
Fort Worth, US	1
Yunnan Universitylocation not on record	1
Seoul, KR	1
Zhejiang Museum of Natural Historylocation not on record	1
Taipei, TW	1
黔东南州民族医药研究所标本室location not on record	1
Xian, CN	1
FJFClocation not on record	1
Odawara, JP	1
Xian, CN	1
EMTCMlocation not on record	1
Taipei, TW	1
Xiamen, CN	1
CASlocation not on record	1
Moscow State Universitylocation not on record	1

46 institutions · 373 of 377 vouchered records shown · 4 without an institution code

09Environmental DNA17 detections

Where the DNA of Eupatorium fortunei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)