Eupatorium compositifolium

Walter · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Eupatorium

At a glance

Occurrence records1 682

Data sources12

Biological traits8

DNA specimens4

eDNA detections2

Sources12 archives

Databases and archives Eupatorium compositifolium's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 682 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Chemical compositionLOTUS · NPASS16 compounds

Occurrence & distributionGBIF1 682 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Eupatorium compositifolium, commonly called Yankeeweed, is a North American herbaceous perennial plant in the family Asteraceae native to the southern United States (from North Carolina to Florida and Texas).Biota of North America Program 2014 county distribution map Like other members of the genus Eupatorium it has inflorescences containing a large number of small, white flower heads, each with 5 disc florets but no ray florets. The plant is 0.5 to 2 metres (20-80 inches) tall. Flowers bloom August to October. Its habitats include sand dunes, disturbed areas, and flat-woods. It is closely related to Eupatorium capillifolium and Eupatorium leptophyllum and some authors consider all of them to be varieties of E. capillifolium. However, E. compositifolium is not as tall as E. capillifolium and is found in drier areas. Because it is not grazed by livestock, and mostly not eaten by wildlife, it is considered undesirable in places like pastures and controlled by means such as herbicides.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Seed mass0.194 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition16 compounds

Compounds documented for Eupatorium compositifolium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Pyrrolizidine alkaloids2

Amarylidaceae alkaloids1

Megastigmanes1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
(1-Hydroxy-2,3,5,7a-tetrahydro-1H-pyrrolizin-7-yl)methyl 2-hydroxy-2-(1-hydroxyethyl)-3-methylbutanoate	present	LOTUS
(1R,12S,14R)-9-methoxy-4-methyl-11-oxa-4-azatetracyclo[8.6.1.01,12.06,17]heptadeca-6(17),7,9-trien-14-ol	present	NPASS
(2R,3R,4S,5S,6R)-2-[(1S,4S,5R)-4-hydroxy-4-[(E,3R)-3-hydroxybut-1-enyl]-3,3,5-trimethylcyclohexyl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
1-(6,7-Dihydroxy-2-prop-1-en-2-yl-1-benzofuran-5-yl)ethanone	present	LOTUS
[(1S,2S,3R,4R,6S,7S,8R,11R,13S,15S)-11-acetyl-7,13-dihydroxy-4,8-dimethyl-14-methylidene-10-oxo-9,16-dioxapentacyclo[6.6.1.12,6.02,6.011,15]hexadecan-3-yl] (2S)-2-methylbutanoate	present	NPASS
[(7R,8R)-7-hydroxy-5,6,7,8-tetrahydro-3H-pyrrolizin-1-yl]methyl (2R)-2-hydroxy-2-[(1R)-1-hydroxyethyl]-3-methylbutanoate	present	NPASS
FTPXPGRUNGQWDZ-NIYLKIKJSA-N	present	NPASS
JAUWZOXYLDSZQN-MSWDUHPKSA-N	present	NPASS
JJULCAHSHXFAGW-TZSGBWKDSA-N	present	NPASS
JRBOWEBYZVKAGB-GKVCMWFDSA-N	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eupatorium compositifolium has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV248101.1 ↗635 bpUSA · 1976

ACGT

TCGAACCCTGGATGGTAAAACAACCCGTGAACGTGTATCAACAAGATGGCTTGGCGGGTACTTGATGCTTCTTGTTTCAATCCCCGTGAA …

Eupatorium compositifolium voucher Genelle & Fleming 2541, TENN internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL5★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eupatorium compositifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Watanabe, K., M. Ito, T. Yahara, V. I. Sullivan, T. Kawahara & D. J. Crawford. 1990. Numerical analyses of karyotype diversity in the genus Eupatorium (Compositae, Eupatorieae). Pl. Syst. Evol. 170: 215–228.

CCDB · eflora

n 101×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Keil, D. J. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 271–273.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 682 records

Wild obs. + sensor1 097

Museum / vouchered585

Range

Area of Occupancy AOO4 100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 619≤1 km 129≤10 km 49>10 km 80

877 georeferenced · 220 without coordinates

Open the mapobservation + sensor1 097

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 19≤1 km 39≤10 km 55>10 km 43

156 georeferenced · 429 without coordinates

Open the institutions mapphysical evidence585

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 48 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	170
Tampa, US	57
Fort Worth, US	36
Bangkok, TH	30
Bronx, US	26
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	22
AUAlocation not on record	20
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	17
Columbia, US	17
Valdosta State Universitylocation not on record	16
Jackson, US	15
Austin, US	15
Miami, US	14
US	13
Tall Timbers Research Stationlocation not on record	12
GAlocation not on record	10
Tuscaloosa, US	10
University of Southern Mississippilocation not on record	8
Clemson, US	7
EL PASO, US	6
Chongqing Museumlocation not on record	6
Mississippi State, US	5
Chapel Hill, US	4
Saint Louis, US	4
Wuzhou, CN	4
Texas Lutheran Universitylocation not on record	4
University of Stellenboschlocation not on record	4
Charleston Southern Universitylocation not on record	2
Little Rock, US	2
Weymouth Woods Sandhills Nature Preservelocation not on record	2
Williamsburg, US	2
Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record	2
Dekalb, US	2
Riverside, US	2
Bloomington, US	2
Baltimore, US	1
Moscow, US	1
CASlocation not on record	1
San Angelo, US	1
Florida Museum of Natural Historylocation not on record	1
Denver, US	1
Knoxville, US	1
Tempe, US	1
Mérida, MX	1
Norfolk, US	1
Flagstaff, US	1
McWane Science Centerlocation not on record	1
BAYLUlocation not on record	1

48 institutions · 581 of 585 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Eupatorium compositifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eupatorium compositifolium

At a glance

Sources12 archives

Size & morphology1

Life cycle & reproduction1

Diet & foraging1

Habitat & environment5

Compound class profile3 classes

Documented compounds16 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 682 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions30 of 48 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 682 records