Euonymus sanguineus

Loes. ex Diels · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Euonymus

At a glance

Occurrence records1 167

Data sources7

Biological traits23

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Euonymus sanguineus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 167 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF1 167 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

披针叶石枣子（学名：）为卫矛科卫矛属下的一个变种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology13

Fruit length10 mm

Fruit length max10 mm

Fruit length min10 mm

Fruit width10 mm

Fruit width max10 mm

Fruit width min10 mm

Leaf length65 mm

Leaf length max90 mm

Leaf length min40 mm

Leaf width35 mm

Leaf width max45 mm

Leaf width min25 mm

Plant height8 m

⚠ sources differ — GIFT: 8 m · TRY: 7 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formshrub or tree

Life spanperennial

Habitat & environment6

Climatetemperate

Climberself-supporting

Elevation max3 500 m

Elevation min2 700 m

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euonymus sanguineus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences9

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF282198.1 ↗535 bpChina

ACGT

CTGGTCGCTCGTGGCCCGGGTGTAGTGCTGCGGGAGACTGCAGCCCCTATGCCCGGGCACAAACAACGAACCCCGGCGCAGAACGCGCCA …

Euonymus sanguineus isolate HL058 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type1 167 records

Wild obs. + sensor3

Museum / vouchered1 158

Cultivated / captive1

Other5

Range

Area of Occupancy AOO836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 1 156 without coordinates

Open the institutions mapphysical evidence1 158

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	386
Chengdu, CN	249
Kunming, CN	138
Yangling, CN	92
Guangzhou, CN	70
Wuhan, CN	54
Chengdu, CN	44
Guilin, CN	23
Seoul, KR	17
Lanzhou, CN	14
Xian, CN	9
Beijing Normal Universitylocation not on record	9
Xining, CN	8
Zhengzhou, CN	6
Chongqing, CN	5
South Kensington, GB	3
Port Elizabeth Museum (Bayworld)location not on record	3
JMSlocation not on record	2
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	2
Peking Universitylocation not on record	2
Philadelphia, US	2
Zhejiang Universitylocation not on record	2
WNNUlocation not on record	2
Chongqing Natural History Museumlocation not on record	2
Shanxi Institute of Biologylocation not on record	2
Nanjing, CN	2
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	1
Zhuzhou, CN	1
Guiyang, CN	1
Shanghai, CN	1
New Haven, US	1
Guizhou Forestry Schoollocation not on record	1
Nanjing, CN	1
Fujian Institute of Subtropical Botanylocation not on record	1
LDlocation not on record	1
Museum of the Rockieslocation not on record	1

36 institutions · 1 158 of 1 158 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Euonymus sanguineus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euonymus sanguineus

At a glance

Sources7 archives

Size & morphology13

Life cycle & reproduction3

Habitat & environment6

Other traits1

At a glance

Record type1 167 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 167 records