Euonymus sachalinensis

(F.Schmidt) Maxim. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Euonymus

At a glance

Occurrence records619

Data sources12

Biological traits12

DNA specimens13

eDNA detections10

Sources12 archives

Databases and archives Euonymus sachalinensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility619 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS · NPASS39 compounds

Occurrence & distributionGBIF619 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB2n = 64

01Narrative

Euonymus sachalinensis (syn. Euonymus planipes), the flat-stalked spindle, is a species of flowering plant in the family Celastraceae, native to Japan, China, Korea, and the Island of Sakhalin (whence the specific epithet sachalinensis). Growing to 2.5 m tall and broad, it is a deciduous shrub notable for its leaves turning red in autumn, and its red fruit which splits open to reveal orange seeds. Exceptional specimens, such as the one in the Hørsholm Arboretum, Copenhagen University, can become trees up to 4 m in height. This plant is cultivated as an ornamental subject. The cultivar 'Sancho' which is more free-flowering than its parent, is a recipient of the Royal Horticultural Society's Award of Garden Merit. Euonymus planipes 2017-05-07 9945b.jpg|Flowers and unripe fruit

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height max3 m

Seed mass50 mg

Seed mass max50 mg

Seed mass min50 mg

Life cycle & reproduction4

Flowering endJul

Flowering startMay

Life formshrub

Life spanperennial

Habitat & environment4

Climatetemperate

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: shrub/tree

Habitat GIFTforest

Woodinesswoody

03Chemical composition39 compounds

Compounds documented for Euonymus sachalinensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives13

Agarofuran sesquiterpenoids4

Flavones3

Pyridine alkaloids3

Flavonols3

Documented compounds39 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4S,5S,6R)-2-[[(2R,3R)-3,7-dihydroxy-2-(3-hydroxy-4-methoxyphenyl)-6-methyl-3,4-dihydro-2H-chromen-5-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2S,3R,4S,5S,6R)-2-[[(2R,3R)-3,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-6-methyl-3,4-dihydro-2H-chromen-5-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(R)-naringenin	present	NPASS
1-O-(4-Hydroxy-trans-cinnamoyl)-2-O-(alpha-D-glucopyranosyl)-6-O-(3-methoxy-4-hydroxy-trans-cinnamoyl)-beta-D-fructofuranose	present	NPASS
2-(3,4-dihydroxyphenyl)-5-hydroxy-3,7-bis[[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy]chromen-4-one	present	NPASS
3,3',4'5-Tetrahydroxystilbene	present	NPASS
3-(3,5-Dihydroxy-phenyl)-2-(4-hydroxy-phenyl)-2,3-dihydro-benzofuran-5-carbaldehyde	present	NPASS
4-[(2R,3R)-3-(3,5-dihydroxyphenyl)-6-hydroxy-4-[(E)-2-(4-hydroxyphenyl)vinyl]-2,3-dihydrobenzofuran-2-yl]benzene-1,2-diol	present	NPASS
5-O-Caffeoylshikimic acid	present	NPASS
[(1R,2S,4R,5S,6R,7R,9S,12S)-4,7,12-triacetyloxy-6-(acetyloxymethyl)-2,10,10-trimethyl-8-oxo-11-oxatricyclo[7.2.1.01,6]dodecan-5-yl] benzoate	present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euonymus sachalinensis has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes4

GenBank sequences8

eDNA detections10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSHQ393723.1 ↗640 bp

ACGT

ATTGTCGAAACCTGCAAAGCAGAACGACCCGCGAACAAGTGAAGAAAACCACGCGGGGGAGCCTCCGGGCTGGTCGCTCGTAGCCCGGGA …

Euonymus sachalinensis voucher M.P. Simmons 1923, cult. Missouri, USA (CS) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL6★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Euonymus sachalinensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 64 n = 32

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 641×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gurzenkov, N. N. 1973. Studies of chromosome numbers of plants from the south of the Soviet Far East. Komarov Lectures. 20: 47–61.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type619 records

Wild obs. + sensor484

Museum / vouchered133

Cultivated / captive1

Other1

Range

Area of Occupancy AOO1 584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 42≤1 km 5≤10 km 3>10 km 38

88 georeferenced · 396 without coordinates

Open the mapobservation + sensor484

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 11≤1 km 8≤10 km 4>10 km 3

26 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence133

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	40
Moscow State Universitylocation not on record	24
SLU Artdatabankenlocation not on record	13
DNSMlocation not on record	10
National Institute of Biological Resourceslocation not on record	9
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	6
Korea National Arboretumlocation not on record	5
Forestry and Forest Products Research Institutelocation not on record	5
Beijing, CN	3
San Sebastián, ES	2
Chengdu, CN	2
Cambridge, US	1
Dekalb, US	1
KIWElocation not on record	1
Kew, GB	1
Olocation not on record	1
València, ES	1
Wlocation not on record	1
Clemson, US	1
Saint Louis, US	1
MeiseBGlocation not on record	1
Vitoria, ES	1
IWEP FEB RASlocation not on record	1

23 institutions · 131 of 133 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Euonymus sachalinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 12.1–16.2

Seasonal swing summer↔winter26.3 °C

Max temp (day)18.2 °C 15.3–20.1

Min temp (night)10.2 °C 8.20–11.4

Precipitation125 mm/mo 76.8–258

Air humidity66.0 % 64.7–66.3

Moisture balance17.2 mm/mo -37.0–151

Vapour deficit558 Pa 480–626

Wind speed2.40 m/s 2.20–2.60

Cloud cover42.8 % 39.0–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)