Euonymus phellomanus

Loes. ex Diels · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Euonymus

At a glance

Occurrence records559

Data sources8

Biological traits32

DNA specimens4

eDNA detections3

Sources8 archives

Databases and archives Euonymus phellomanus's data was compiled from.

GBIFGlobal Biodiversity Information Facility559 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources32 traits

Chemical compositionNPASS12 compounds

Occurrence & distributionGBIF559 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceGoaT641 Mbp

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Fruit length8 mm

Fruit length max9 mm

Fruit length min7 mm

Fruit width10 mm

Fruit width max10 mm

Fruit width min10 mm

Leaf length85 mm

Leaf length max110 mm

Leaf length min60 mm

Leaf width30 mm

Leaf width max40 mm

Leaf width min20 mm

Plant height3.5 m

⚠ sources differ — GIFT: 3.5 m · TRY: 5.2 m

Plant height max4 m

Plant height min3 m

Seed mass28.17 mg

Life cycle & reproduction5

Deciduousnessdeciduous

Flowering startDec

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 000 m

Elevation mean2 000 m

Elevation min2 000 m

Epiphyteterrestrial

Growth formshrub

Habitat GIFTLowland

Woodinesswoody

03Chemical composition12 compounds

Compounds documented for Euonymus phellomanus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Simple coumarins7

Coumarinolignans2

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
6,7-dimethoxy-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-2-one	present	NPASS
7-[(2S,3R,4S,5S,6R)-3-[(2S,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-methoxychromen-2-one	present	NPASS
9H-Pyrano(2,3-f)-1,4-benzodioxin-9-one, 2,3-dihydro-2-(4-hydroxy-3-methoxyphenyl)-3-(hydroxymethyl)-5-methoxy-, trans-(+-)-	present	NPASS
Calycanthoside	present	NPASS
Cleomiscosin D	present	NPASS
Fraxetin	present	NPASS
Fraxidin	present	NPASS
Isofraxidin	present	NPASS
MSSOSOXUURLBHN-XLCXBCOCSA-N	present	NPASS
PYDAEIINPZJDBO-HEICXWOHSA-N	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euonymus phellomanus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences9

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX776116.1 ↗212 bpChina · 2025

ACGT

CGCAACGTCGCCACCCCCACCCCCCCACGGGGAAGGCGTGGGATGGCGGATATTGGCCTCCCGTGCGCTCCCGCTCGCGGTTGGCCTAAA …

Euonymus phellomanus voucher Ep_SX_YCRCLD_12 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Euonymus phellomanus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size640 590 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Euonymus phellomanus0.64 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidy2× diploid · measured

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type559 records

Wild obs. + sensor7

Museum / vouchered552

Range

Area of Occupancy AOO504 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1≤1 km 3≤10 km 1

5 georeferenced · 2 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 552 records without

Open the institutions mapphysical evidence552

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yangling, CN	142
Chengdu, CN	118
Beijing, CN	103
Lanzhou, CN	30
WNNUlocation not on record	25
Wuhan, CN	24
Zhengzhou, CN	18
Guangzhou, CN	17
Kunming, CN	15
Chengdu, CN	11
Xinxiang, CN	9
Xian, CN	6
Seoul, KR	5
Guilin, CN	5
Xining, CN	3
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	3
Fujian Institute of Subtropical Botanylocation not on record	2
Xian, CN	2
Shanxi Institute of Biologylocation not on record	2
Nanjing, CN	1
Chongqing Natural History Museumlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
Guiyang, CN	1
Chongqing, CN	1
Central China Agricultural Universitylocation not on record	1
Yunnan Universitylocation not on record	1
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	1
Shanghai, CN	1
Beijing Normal Universitylocation not on record	1

30 institutions · 551 of 552 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Euonymus phellomanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median29.2 °C 29.2–29.2

Seasonal swing summer↔winter24.7 °C

Max temp (day)32.0 °C

Min temp (night)26.2 °C

Precipitation264 mm/mo

Air humidity63.0 %

Moisture balance91.8 mm/mo

Vapour deficit1,505 Pa

Wind speed2.90 m/s

Cloud cover40.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)