Euonymus occidentalis

Nutt. ex Torr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Euonymus

At a glance

Occurrence records661

Data sources10

Biological traits15

DNA specimens7

eDNA detections4

Sources10 archives

Databases and archives Euonymus occidentalis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility661 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF661 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Euonymus occidentalis is a species of spindle tree known by the common names western burning bush and western wahoo.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height6.1 m

Seed mass18.88 mg

Seed mass max18.88 mg

Seed mass min18.88 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Dispersal typeanimal

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub, Tree

Woodinesswoody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euonymus occidentalis has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences5

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMF963916.1 ↗693 bpUSA

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGAACGACCCGTGAACAAGTGAAAACCA …

Euonymus occidentalis isolate CBP175 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type661 records

Wild obs. + sensor492

Museum / vouchered169

Origin

Native28

Range

Area of Occupancy AOO1 224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 259≤1 km 59≤10 km 22>10 km 60

400 georeferenced · 92 without coordinates

Open the mapobservation + sensor492

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 9≤1 km 46≤10 km 48>10 km 7

110 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence169

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	31
Claremont, US	28
Arcata, US	17
Pullman, US	16
Portland, US	11
WTUlocation not on record	10
Santa Cruz, US	7
Angwin, US	6
STNFlocation not on record	4
Davis, US	4
CASlocation not on record	3
San Diego, US	3
Riverside, US	3
Victoria, CA	2
San Luis Obispo, US	2
Irvine, US	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
KNFHClocation not on record	2
Portland, US	1
Mexico City, MX	1
Chongqing Museumlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Ashland, US	1
Los Angeles, US	1
KNFYlocation not on record	1
Moscow, US	1
University of Stellenboschlocation not on record	1
University of British Columbia, Herbariumlocation not on record	1
San Francisco, US	1
San Jose, US	1
Bloomington, US	1
Santa Barbara, US	1

32 institutions · 167 of 169 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Euonymus occidentalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

Riparianunburned in Poomacha fire, 2007: Quercus chr…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.0 °C 18.2–21.7

Seasonal swing summer↔winter14.2 °C

Max temp (day)26.3 °C 23.2–29.3

Min temp (night)15.1 °C 14.3–15.8

Precipitation23.9 mm/mo 9.60–38.2

Air humidity54.3 % 51.3–57.3

Moisture balance-131 mm/mo -159–-104

Vapour deficit1,089 Pa 901–1,277

Wind speed1.50 m/s 1.30–1.70

Cloud cover23.9 % 14.8–33.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)