Euonymus obovatus

Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Euonymus

At a glance

Occurrence records3 539

Data sources10

Biological traits13

DNA specimens5

eDNA detections2

Sources10 archives

Databases and archives Euonymus obovatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility3 539 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF3 539 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceGoaT479 Mbp

01Narrative

Euonymus obovatus, the running strawberry bush, is a trailing, woodland groundcover plant of the family Celastraceae, which is native to eastern North America in the eastern United States and southeastern Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass20.03 mg

Seed mass max23.76 mg

Seed mass min17.7 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberfacultative

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition1 compounds

Compounds documented for Euonymus obovatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pyridine alkaloids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Nicotinamide		present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euonymus obovatus has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG235404.1 ↗340 bpCanada · 2007

ACGT

TGCAGAATCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCAAC …

Euonymus obovatus voucher JAG 0845 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Euonymus obovatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size479 220 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Euonymus obovatus0.48 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidy2× diploid · measured

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type3 539 records

Wild obs. + sensor3 106

Museum / vouchered429

Cultivated / captive2

Other2

Range

Area of Occupancy AOO6 564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 595≤1 km 447≤10 km 146>10 km 331

2 519 georeferenced · 587 without coordinates

Open the mapobservation + sensor3 106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 24≤1 km 112≤10 km 119>10 km 11

266 georeferenced · 163 without coordinates

Open the institutions mapphysical evidence429

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bloomington, US	93
Chongqing Museumlocation not on record	85
Ann Arbor, US	58
Toronto, CA	36
Chapel Hill, US	20
McWane Science Centerlocation not on record	19
Philadelphia, US	16
Saint Louis, US	10
Bangkok, TH	9
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	7
Wuzhou, CN	6
Chicago, US	5
Little Rock, US	5
Acadia Universitylocation not on record	4
San Jose State University, Museum of Birds and Mammalslocation not on record	3
BAYLUlocation not on record	3
Museum of the Rockieslocation not on record	3
University of Alberta Museumslocation not on record	3
Philadelphia, US	3
Durham, US	2
Québec, CA	2
Boise, US	2
Royal Botanical Gardenslocation not on record	2
University of Guelph, OAC Herbariumlocation not on record	2
Williamsburg, US	2
Asheville, US	1
Long Beach, US	1
Burlington, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Springfield, US	1
Fayetteville, US	1
GAlocation not on record	1
Paris, FR	1
Knoxville, US	1
Mississippi State, US	1
Due West, US	1
Fredericksburg, US	1
Denver, US	1
Western Carolina Universitylocation not on record	1
Tampa, US	1
Northridge, US	1
University of Southern Mississippilocation not on record	1
Beijing, CN	1
Cincinnati, US	1
Harrisonburg, US	1

46 institutions · 421 of 429 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Euonymus obovatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 11.8–14.0

Seasonal swing summer↔winter26.7 °C

Max temp (day)15.7 °C 14.5–16.9

Min temp (night)11.0 °C 10.2–11.8

Precipitation89.9 mm/mo 86.9–92.9

Air humidity59.2 % 59.0–59.4

Moisture balance-10.2 mm/mo -42.4–22.1

Vapour deficit611 Pa 564–658

Wind speed4.60 m/s 3.70–5.60

Cloud cover48.6 % 44.8–52.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euonymus obovatus

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Compound class profile1 class

Documented compounds1 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type3 539 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions31 of 46 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 539 records