Euonymus nanus

M.Bieb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Euonymus

At a glance

Occurrence records546

Data sources10

Biological traits33

DNA specimens4

eDNA detections3

Sources10 archives

Databases and archives Euonymus nanus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility546 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Chemical compositionLOTUS · NPASS47 compounds

Occurrence & distributionGBIF546 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Берескле́т ка́рликовый — кустарник, вид рода Бересклет (Celastraceae) семейства Бересклетовые (Celastraceae). Ранее родовое название Euonymus считалось женского рода, поэтому правильным названием вида считалось Euonymus nana. Очень похож на него бересклет туркестанский, ботаники иногда объединяют их в одну группу.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology17

Fruit length7 mm

Fruit length max7 mm

Fruit length min7 mm

Fruit width9 mm

Fruit width max9 mm

Fruit width min9 mm

Inflorescence length max3 cm

Inflorescence length min2 cm

Leaf length25 mm

Leaf length max35 mm

Leaf length min15 mm

Leaf width4.25 mm

Leaf width max6 mm

Leaf width min2.5 mm

Plant height1 m

Plant height max1 m

Plant height min0.3 m

Life cycle & reproduction7

Deciduousnessdeciduous

Flower length max8 mm

Flower length min7 mm

Flowering endJul

Flowering startJul

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 800 m

Epiphyteterrestrial

Growth formshrub

Habitat GIFTbroadleaved forests and shrubby formations in plains and foothills, slope sand valleys, conifer mountainous forest and shrubby thickets on rocky slopes

Woodinesswoody

03Chemical composition47 compounds

Compounds documented for Euonymus nanus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones6

Phenylethanoids5

Pyridine alkaloids4

Agarofuran sesquiterpenoids3

Cinnamic acids and derivatives2

Documented compounds47 total

Tissue Source Quantified only

Compound	Amount	Source
(3aR,7aS)-Hexahydro-3a-hydroxy-6(2H)-benzofuranone	present	NPASS
2-(3,4-Dihydroxyphenyl)ethyl beta-D-glucopyranoside	present	NPASS
4-Hydroxy-1,2,6,15-tetraacetyl-9-benzoylagarofuran	present	LOTUS
4-hydroxy-4-[2-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyethyl]cyclohexa-2,5-dien-1-one	present	NPASS
4-hydroxy-4-[2-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyethyl]cyclohexan-1-one	present	NPASS
6,7-Dimethylscutellarein	present	NPASS
6-Methylscutellarein	present	NPASS
8,11-Epoxy-9,12-ethano-11,15-methano-11H-[1,8]dioxacycloheptadecino[4,3-b]pyridine-5,17,22-trione, 10,13,14,21-tetrakis(acetyloxy)-12-[(acetyloxy)methyl]-7,8,9,10,12,13,14,15,18,19-decahydro-20-hydroxy-8,18,19,20-tetramethyl-	present	LOTUS
[(1R,3S,13R,14R,17R,18R,19R,20S,21R,23S,24R,25S)-18,19,21,24-tetraacetyloxy-25-hydroxy-3,13,14,25-tetramethyl-6,15,22-trioxo-2,5,16-trioxa-11-azapentacyclo[15.7.1.01,20.03,23.07,12]pentacosa-7(12),8,10-trien-20-yl]methyl acetate	present	LOTUS
[(1S,2S,4S,5R,6R,7S,9R,12R)-4,12-diacetyloxy-6-(acetyloxymethyl)-2-hydroxy-2,10,10-trimethyl-5-(2-methylpropanoyloxy)-11-oxatricyclo[7.2.1.01,6]dodecan-7-yl] benzoate	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euonymus nanus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW382650.1 ↗611 bp

ACGT

TGCAAAGCAGAACGACCCGCGAACAAGTTGAAACCACCACGTGCGGCATGCCTCCGGGCTCGTCGCTCGTAGTCCAGGAGTAGGGATGTG …

Euonymus nanus voucher WYJ201904450 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★rbcLa★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type546 records

Wild obs. + sensor326

Museum / vouchered214

Cultivated / captive6

Origin

Introduced1

Range

Area of Occupancy AOO840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 211≤1 km 35≤10 km 8>10 km 7

261 georeferenced · 65 without coordinates

Open the mapobservation + sensor326

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 43≤1 km 11≤10 km 18>10 km 3

75 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence214

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 4 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yangling, CN	21
Moscow State Universitylocation not on record	20
SLU Artdatabankenlocation not on record	18
Beijing, CN	17
Tartu, EE	10
LDlocation not on record	9
Lanzhou, CN	7
Olocation not on record	7
WNNUlocation not on record	5
Uppsala, SE	5
Oskarshamn, SE	4
Görlitz, DE	3
University of Stellenboschlocation not on record	3
Xian, CN	3
Jiangxi College of Educationlocation not on record	3
BRNUlocation not on record	3
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	3
MeiseBGlocation not on record	3
Adam Mickiewicz University in Poznańlocation not on record	2
Stockholm, SE	2
Uniwersytet Jagiellońskilocation not on record	2
Ivano-Frankove, UA	2
Kew, GB	1
Universität Göttingenlocation not on record	1
Beijing Normal Universitylocation not on record	1
Vancouver, CA	1
Lincoln, US	1
Xining, CN	1
Inner Mongolia Universitylocation not on record	1
Guangzhou, CN	1
Philadelphia, US	1
Philadelphia, US	1
Jyväskylä, FI	1
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	1
Bern, CH	1
Kunming, CN	1
Christchurch, NZ	1
College Park, US	1
Edinburgh, GB	1

39 institutions · 169 of 214 vouchered records shown · 45 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Euonymus nanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

Cultivated

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)