Euonymus fortunei
(Turcz.) Hand.-Mazz. · speciesAt a glance
Occurrence records27 135
Data sources13
Biological traits114
DNA specimens7
eDNA detections19
Sources13 archives
Databases and archives Euonymus fortunei's data was compiled from.
WikipediaWikimedia Foundation10 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility27 135 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics7 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources114 traits
Chemical compositionLOTUS · NPASS120 compounds
Occurrence & distributionGBIF27 135 records
Environmental DNA1 datasets · 3 countries19 detections
DNA & barcodingBOLD · NCBI7 specimens
Genome at a glanceCCDB2n = 32
01Narrative
Euonymus fortunei, the spindle, Fortune's spindle, winter creeper or wintercreeper, is a species of flowering plant in the family Celastraceae, native to east Asia, including China, Korea, the Philippines and Japan. It is named after the Scottish botanist and plant explorer Robert Fortune. Euonymus is highly invasive and damaging in the United States, causing the death of trees and forest in urban areas.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology18
Fruit length9 mm
Fruit length max12 mm
Fruit length min6 mm
Fruit width9 mm
Fruit width max12 mm
Fruit width min6 mm
Leaf length57.5 mm
Leaf length max80 mm
Leaf length min35 mm
Leaf width27.5 mm
Leaf width max40 mm
Leaf width min15 mm
Plant height1 m
⚠ sources differ — GIFT: 1 m · USDA: 0.305 m · TRY: 3.05 m
Plant height max2.5 m
Plant height min2 m
Seed mass13.12 mg
Seed mass max13.12 mg
Seed mass min13.12 mg
Life cycle & reproduction25
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Flower colourpurple
Flower conspicuousNo
Flowering startDec
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDARapid
Life formscrambling subshrub or shrub
Life spanModerate
⚠ sources differ — TRY: Moderate · GIFT: perennial
Lifespan categoryModerate
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityYes
Seed spread rateNone
Vegetative spread rateModerate
Diet & foraging1
Parasiteindependent
Habitat & environment25
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterModerate
Foliage textureCoarse
Fruit colourpurple
Growth formshrub
Growth form USDAStoloniferous
Habitat GIFTLowland
Hedge toleranceNone
Known allelopathNo
Leaf retentionYes
Low growing grassNo
Root depth min16 in
Shape and orientationDecumbent
Small grainNo
Woodinesswoody
Physiology & chemistry24
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min140 days
Leaf C:N ratio46.87 g/g
Leaf c513 mg/g
Leaf dry-matter content (LDMC)368 mg/g
Leaf n10.95 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min32 in
Protein potentialLow
Salinity toleranceLow
Shade toleranceLow
Soil pH max7.5 pH
Soil pH min5 pH
Temperature min-13 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits7
Fall conspicuousYes
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Height at 20yr3.05 m
Planting density max1 700 per acre
Planting density min1 200 per acre
03Chemical composition120 compounds
Compounds documented for Euonymus fortunei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Aporphine alkaloids $ Isoquinoline alkaloids20
Kaurane and Phyllocladane diterpenoids10
Cinnamic acid amides8
Simple phenolic acids8
Cyclic peptides6
Documented compounds120 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Episyringaresinol | present | NPASS | |
| (+)-Syringaresinol | present | NPASS | |
| (-)-Corydalmine | present | NPASS | |
| (-)-Kaur-16-en-19-oic acid | present | NPASS | |
| (-)-Nornuciferine | present | NPASS | |
| (1S)-1-[(4-hydroxy-3-methoxyphenyl)methyl]-6-methoxy-2-methyl-3,4-dihydro-1H-isoquinolin-7-ol | present | NPASS | |
| (1S,4R,9R,10R,13R,14R)-14-(hydroxymethyl)-5,5,9-trimethyl-tetracyclo[11.2.1.01,10.04,9]hexadecan-14-ol | present | NPASS | |
| (1S,4R,9R,10R,13R,14S)-14-(hydroxymethyl)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecan-14-ol | present | NPASS | |
| (1S,4S,5R,9S,10R,13R,14R)-14-(acetyloxymethyl)-5,9-dimethyltetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid | present | NPASS | |
| (1S,4S,5R,9S,10R,13R,14R)-14-(dimethoxymethyl)-5,9-dimethyltetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid | present | NPASS |
05DNA & barcoding7 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euonymus fortunei has left across the world's sequence archives.
At a glance
DNA specimens7
Marker genes3
GenBank sequences10
eDNA detections19
Countries3
The DNA barcodea real sequence read deposited for this species
GCTGGCGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCT …
Euonymus fortunei isolate DNAS2-4-QLS ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL9★rbcLa
plant barcode
06Genome at a glanceCCDB
The complete instruction manual Euonymus fortunei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidypolyploid inferred
Chromosome records32–322n range32median32mode2records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 322×CCDB · ipcn-api-dl · CCDB · book-fedorov
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.
CCDB · book-fedorov — Bowden 1940a
n 162×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — NATH, J., & S.N. CLAY. 1972. Cytogenetic studies on some species of Euonymus. Caryologia 25: 417-427.
n 321×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — NATH, J., & S.N. CLAY. 1972. Cytogenetic studies on some species of Euonymus. Caryologia 25: 417-427.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type27 135 records
Wild obs. + sensor24 710
Museum / vouchered2 397
Cultivated / captive7
Other21
Origin
Native3
Introduced14
Range
Area of Occupancy AOO54 872 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy93% within 1 km
≤100 m 17 197≤1 km 2 403≤10 km 731>10 km 817
21 148 georeferenced · 3 562 without coordinates
Open the mapobservation + sensor24 710
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 157≤1 km 93≤10 km 226>10 km 12
488 georeferenced · 1 909 without coordinates
Open the institutions mapphysical evidence2 397
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 6
6 georeferenced · 1 without coordinates
Open the mapnot free-living7
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions111 of 198 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 372 |
| Kunming, CN | 164 |
| Guangzhou, CN | 122 |
| Yangling, CN | 97 |
| Shinshu Universitylocation not on record | 81 |
| Nagano City, JP | 72 |
| Chengdu, CN | 63 |
| Bando, JP | 47 |
| Kochi, JP | 47 |
| Guilin, CN | 46 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 45 |
| Wuzhou, CN | 44 |
| Wuhan, CN | 43 |
| SLU Artdatabankenlocation not on record | 38 |
| Chengdu, CN | 31 |
| Central China Normal Universitylocation not on record | 28 |
| University of New Hampshirelocation not on record | 27 |
| Hangzhou, CN | 27 |
| Toyama, JP | 22 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 22 |
| Nagatoro-machi, Chichibu-gun, JP | 21 |
| Anhui Normal Universitylocation not on record | 20 |
| Christchurch, NZ | 20 |
| MeiseBGlocation not on record | 20 |
| LDlocation not on record | 20 |
| Chongqing Museumlocation not on record | 20 |
| Saint Louis, US | 19 |
| Sanda, JP | 19 |
| Philadelphia, US | 18 |
| Bloomington, US | 18 |
| Changsha, CN | 18 |
| Taipei, TW | 18 |
| Guiyang, CN | 17 |
| Bronx, US | 17 |
| Knoxville, US | 16 |
| Univesity of New Hampshirelocation not on record | 16 |
| KR | 15 |
| Ann Arbor, US | 15 |
| Osaka, JP | 15 |
| Tokushima, JP | 14 |
| Wuhan, CN | 14 |
| Fukushima Universitylocation not on record | 13 |
| Provincia di Livornolocation not on record | 13 |
| Little Rock, US | 12 |
| Jackson, US | 11 |
| Zhejiang Universitylocation not on record | 11 |
| Seoul, KR | 11 |
| Sendai, JP | 10 |
| Hunan Hupingshan National Nature Reservelocation not on record | 10 |
| Minia, EG | 9 |
| Xian, CN | 9 |
| GJOlocation not on record | 9 |
| Otaru, JP | 9 |
| Emporia, US | 9 |
| Zhejiang Museum of Natural Historylocation not on record | 9 |
| Salzburg, AT | 9 |
| JP | 9 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 8 |
| Chapel Hill, US | 8 |
| Xinxiang, CN | 8 |
| Fairfax, US | 7 |
| Tomioka, JP | 7 |
| KOMlocation not on record | 7 |
| Nanjing, CN | 6 |
| National Institute of Biological Resourceslocation not on record | 6 |
| PRClocation not on record | 6 |
| Lincoln, US | 6 |
| Shanghai, CN | 6 |
| Fujian Institute of Subtropical Botanylocation not on record | 6 |
| Columbia, US | 6 |
| Millersville, US | 5 |
| Guiyang, CN | 5 |
| Görlitz, DE | 5 |
| FFPRIlocation not on record | 5 |
| University of Stellenboschlocation not on record | 5 |
| Iwate Prefectural Museumlocation not on record | 5 |
| McWane Science Centerlocation not on record | 5 |
| Kyoto Universitylocation not on record | 5 |
| Western Carolina Universitylocation not on record | 5 |
| Zhuzhou, CN | 5 |
| Zhengzhou, CN | 5 |
| Cincinnati, US | 5 |
| Boise, US | 5 |
| Frankfurt am Main | 4 |
| FJIDClocation not on record | 4 |
| College Park, US | 4 |
| Denver, US | 4 |
| Allentown, US | 4 |
| DBF-NHMDlocation not on record | 4 |
| Bangkok, TH | 4 |
| KIRMlocation not on record | 4 |
| Oskarshamn, SE | 4 |
| Portland, US | 4 |
| Pittsburg, US | 4 |
| GAlocation not on record | 4 |
| Kagoshima, JP | 4 |
| Chicago, US | 3 |
| TAIElocation not on record | 3 |
| Mlocation not on record | 3 |
| New Haven, US | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Taipei, TW | 3 |
| Henderson State Universitylocation not on record | 3 |
| Chongqing, CN | 3 |
| Riverside, US | 3 |
| Morgantown, US | 3 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 3 |
| Wellington, NZ | 3 |
| Lanzhou, CN | 3 |
| EMTCMlocation not on record | 3 |
| Elocation not on record | 3 |
| Nanjing, CN | 3 |
| Beijing, CN | 3 |
| Shanghai, CN | 3 |
| Williamsburg, US | 3 |
| Chadron, US | 3 |
| Chongqing Natural History Museumlocation not on record | 3 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| Tampa, US | 2 |
| Hokkaido University Museumlocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Auckland, NZ | 2 |
| Wlocation not on record | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Pullman, US | 2 |
| EL PASO, US | 2 |
| Johnson City, US | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Macomb, US | 2 |
| Xiamen, CN | 2 |
| KMNlocation not on record | 2 |
| Madison, US | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Plocation not on record | 2 |
| Cambridge, US | 2 |
| WTUlocation not on record | 2 |
| West Virginia Wesleyan Collegelocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Mohonk Preservelocation not on record | 2 |
| Olocation not on record | 2 |
| AUAlocation not on record | 2 |
| Logan, US | 2 |
| Oiso Municipal Museumlocation not on record | 2 |
| Dover, US | 2 |
| Harrisonburg, US | 2 |
| University of Tennessee at Chattanoogalocation not on record | 2 |
| Awka, NG | 2 |
| Ischia Marine Centrelocation not on record | 2 |
| Jishou Universitylocation not on record | 2 |
| Chengdu, CN | 2 |
| Burlington, US | 2 |
| Moscow State Universitylocation not on record | 2 |
| Conway, US | 1 |
| SZUlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Richmond, US | 1 |
| Guangzhou, CN | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 1 |
| Port Elizabeth Museum (Bayworld)location not on record | 1 |
| Québec, CA | 1 |
| Central China Agricultural Universitylocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| BSBIlocation not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| BFLlocation not on record | 1 |
| BRNUlocation not on record | 1 |
| Guatemala City, GT | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| GREENVILLElocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| New Brunswick, US | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| Whitehorse, CA | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Claremont, US | 1 |
| Peking Universitylocation not on record | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Vancouver, CA | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| UEMlocation not on record | 1 |
| The Cattle Museumlocation not on record | 1 |
| Chicago, US | 1 |
| SIHUlocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Tuscaloosa, US | 1 |
| UNESP-FCAlocation not on record | 1 |
| Portland, US | 1 |
| Fort Worth, US | 1 |
| Mississippi State, US | 1 |
| Taipei, TW | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Corvallis, US | 1 |
| Brussel, BE | 1 |
| Fayetteville, US | 1 |
198 institutions · 2 354 of 2 397 vouchered records shown · 37 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Euonymus fortunei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.4 °C 10.0–23.3
Seasonal swing summer↔winter24.7 °C
Max temp (day)20.8 °C 15.7–25.9
Min temp (night)12.8 °C 3.10–21.7
Precipitation192 mm/mo 13.8–307
Air humidity63.7 % 45.7–68.1
Moisture balance60.5 mm/mo -95.2–192
Vapour deficit820 Pa 594–1,027
Wind speed3.00 m/s 2.10–4.50
Cloud cover38.7 % 24.1–47.0
CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.