Euonymus fimbriatus

Wall. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Euonymus

At a glance

Occurrence records167

Data sources9

Biological traits18

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Euonymus fimbriatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility167 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF167 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 32

01Narrative

繸叶卫矛（学名：）为卫矛科卫矛属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Leaf length70 mm

Leaf length max100 mm

Leaf length min40 mm

Leaf width35 mm

Leaf width max45 mm

Leaf width min25 mm

Plant height10.5 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formshrub or tree

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max3 000 m

Elevation mean2 650 m

Elevation min3 000 m

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euonymus fimbriatus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSHQ393710.1 ↗682 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCGAAGCAGAACGACCCGCGAACAAGTGAAAAACATCGCGGGCGGCGGG …

Euonymus fimbriatus voucher M.W. Chase 36535, cult, United Kingdom (K) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Euonymus fimbriatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Mehra, P.N. & Sareen, T.S. 1969; Sareen, T.S., Khosla, P.K. & Mehta, P.N. 1974

n 163×CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74

CCDB · book-ipcn67-71 — MEHRA, P.N., & T.S. SAREEN. 1969. In IOPB chromosome number reports XXII. Taxon 18: 433-442.

CCDB · book-ipcn75-78 — Mehra 1976

CCDB · book-ipcn73-74 — SAREEN, T.S., P.K. KHOSLA, & P.N. MEHRA. 1974. Meiotic studies in Himalayan Celastraceae and Rhamnaceae. Cytologia 39: 335-339.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type167 records

Museum / vouchered151

Other16

Range

Area of Occupancy AOO416 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤1 km 6≤10 km 7>10 km 50

63 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence151

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GMBAlocation not on record	55
Yangling, CN	47
South Kensington, GB	27
QAUlocation not on record	4
Xining, CN	3
Dehra Dun, IN	3
Baroda, IN	2
Beijing, CN	2
Edinburgh, GB	2
Guilin, CN	1
Kew, GB	1
Natural History Museum, Tribhuvan Universitylocation not on record	1
University of Stellenboschlocation not on record	1
Philadelphia, US	1
Pondicherry, IN	1

15 institutions · 151 of 151 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Euonymus fimbriatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)