Euonymus alatus
(Thunb.) Siebold · speciesAt a glance
Occurrence records38 183
Data sources13
Biological traits123
DNA specimens22
eDNA detections42
Sources13 archives
Databases and archives Euonymus alatus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility38 183 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics22 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources123 traits
Chemical compositionLOTUS · NPASS139 compounds
Occurrence & distributionGBIF38 183 records
Environmental DNA1 datasets · 4 countries42 detections
DNA & barcodingBOLD · NCBI22 specimens
Genome at a glanceCCDB648 Mbp
01Narrative
Euonymus alatus (Thunb.) Siebold, 1830, ou fusain ailé, fusain ardent ou buisson ardent, est une espèce de plante de la famille des Celastraceae, originaire de Chine centrale et septentrionale, du Japon, et de Corée.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology16
Fruit length7.5 mm
Fruit length max8 mm
Fruit length min7 mm
Leaf length50 mm
Leaf length max80 mm
Leaf length min20 mm
Leaf size1 031 mm²
Leaf width20 mm
Leaf width max30 mm
Leaf width min10 mm
Plant height2 m
⚠ sources differ — GIFT: 2 m · USDA: 6.1 m · TRY: 2.44 m
Plant height max3 m
Plant height min1 m
Seed mass17.07 mg
Seed mass max18.2 mg
Seed mass min15 mg
Life cycle & reproduction27
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessdeciduous
Flower colourpurple
Flower conspicuousNo
Flowering endJun
Flowering startDec
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formshrub
Life spanperennial
Lifespan categoryModerate
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityYes
Seed spread rateSlow
Seedling vigorMedium
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment27
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterModerate
Foliage textureCoarse
Fruit colourpurple
Growth formshrub
Growth form USDAMultiple Stem
Habitat GIFTforest, mountains, rivers, roadsides, shrubberies, stony places
Hedge toleranceHigh
Known allelopathNo
Leaf formelliptic
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min24 in
Shape and orientationVase
Small grainNo
Woodinesswoody
Physiology & chemistry26
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredYes
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min100 days
Leaf C:N ratio26.42 g/g
Leaf c484 mg/g
Leaf dry-matter content (LDMC)292 mg/g
Leaf n20.66 mg/g
Leaf p1.73 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max55 in
Precipitation min35 in
Protein potentialLow
Salinity toleranceLow
Shade toleranceHigh
Soil pH max7.5 pH
Soil pH min5 pH
Specific leaf area (SLA)23.74 mm²/mg
Temperature min-28 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound25 000 per lb
ToxicityNone
Veneer productNo
Other traits11
Defenseyes
Fall conspicuousYes
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Height at 20yr1.52 m
Leaf marginentire
Leaf spinesno
Leaf thornsno
Planting density max4 800 per acre
Planting density min1 700 per acre
03Chemical composition139 compounds
Compounds documented for Euonymus alatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking🌿 Tea
Compound class profile5 classes
Neolignans33
Flavonols9
Pyridine alkaloids9
Furofuranoid lignans7
Cinnamic acids and derivatives6
Documented compounds139 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Dehydrodiconiferyl Alcohol | present | LOTUS | |
| (+)-Simulanol | present | LOTUS | |
| (+)-Syringaresinol | present | LOTUS | |
| (-)-Catechol | present | NPASS | |
| (-)-Episyringaresinol | present | NPASS | |
| (-)-erythro-(7S,8R)-syringylglycerol-8-O-4'-(sinapoyl alcohol) ether | present | LOTUS | |
| (-)-Simulanol | present | LOTUS | |
| (-)-Usnic Acid | present | NPASS | |
| (13R,17S)-17-[(1S)-1-hydroxypropyl]-1,5,10-triazabicyclo[11.4.0]heptadec-15-en-11-one | present | NPASS | |
| (13R,17S)-17-[(1S)-1-hydroxypropyl]-11-oxo-1,5,10-triazabicyclo[11.4.0]heptadec-15-ene-5-carbaldehyde | present | NPASS |
05DNA & barcoding22 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euonymus alatus has left across the world's sequence archives.
At a glance
DNA specimens22
Marker genes7
GenBank sequences10
eDNA detections42
Countries4
The DNA barcodea real sequence read deposited for this species
CGCAACGTCGCCACCCCACCCCCCACGGGGACTGAGTGGGACGGCGGATATTGGCCTCCCGTGCGCTCCCGCTCGCGGTTGGCCCAAAAC …
Euonymus alatus voucher Ea_JL_YB_08 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL★rbcLa★ITS10★ITS2atpF-atpH
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Euonymus alatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size647 925 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Euonymus alatus0.65 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 64 n = 32
Ploidy2× diploid · measured
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
n 321×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — NATH, J., & S.N. CLAY. 1972. Cytogenetic studies on some species of Euonymus. Caryologia 25: 417-427.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type38 183 records
Wild obs. + sensor33 081
Museum / vouchered5 087
Cultivated / captive13
Other2
Origin
Introduced9
Range
Area of Occupancy AOO76 492 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy92% within 1 km
≤100 m 21 713≤1 km 2 560≤10 km 1 003>10 km 1 049
26 325 georeferenced · 6 756 without coordinates
Open the mapobservation + sensor33 081
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 161≤1 km 261≤10 km 377>10 km 50
849 georeferenced · 4 238 without coordinates
Open the institutions mapphysical evidence5 087
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 2
2 georeferenced · 11 without coordinates
Open the mapnot free-living13
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions137 of 245 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 809 |
| Yangling, CN | 727 |
| Chengdu, CN | 276 |
| Wuhan, CN | 258 |
| KR | 186 |
| Guangzhou, CN | 176 |
| Kunming, CN | 116 |
| Guilin, CN | 99 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 86 |
| Chongqing Museumlocation not on record | 63 |
| Odawara, JP | 62 |
| Nagano City, JP | 60 |
| Chengdu, CN | 57 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 55 |
| Philadelphia, US | 50 |
| Millersville, US | 50 |
| Hangzhou, CN | 48 |
| Xian, CN | 46 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 45 |
| Zhengzhou, CN | 45 |
| Nagatoro-machi, Chichibu-gun, JP | 45 |
| Xining, CN | 44 |
| Kyoto Universitylocation not on record | 39 |
| Lanzhou, CN | 39 |
| Madison, US | 38 |
| Wuzhou, CN | 36 |
| Bando, JP | 34 |
| Anhui Normal Universitylocation not on record | 33 |
| NSMKlocation not on record | 32 |
| Allentown, US | 32 |
| Saint Louis, US | 31 |
| Knoxville, US | 29 |
| Nanjing, CN | 28 |
| New Haven, US | 26 |
| Moscow State Universitylocation not on record | 25 |
| Philadelphia, US | 25 |
| Zhejiang Universitylocation not on record | 25 |
| Bloomington, US | 22 |
| College Park, US | 22 |
| Central China Normal Universitylocation not on record | 20 |
| Xian, CN | 20 |
| Bronx, US | 20 |
| Servico de Microbiologia e Imunologialocation not on record | 19 |
| Xinxiang, CN | 18 |
| Hiratsuka City Museumlocation not on record | 17 |
| Central China Agricultural Universitylocation not on record | 16 |
| Shanxi Institute of Biologylocation not on record | 16 |
| Ann Arbor, US | 16 |
| Burlington, US | 16 |
| Kochi, JP | 14 |
| McWane Science Centerlocation not on record | 14 |
| National Institute of Biological Resourceslocation not on record | 14 |
| Chiba, JP | 13 |
| Zhuzhou, CN | 13 |
| Sanda, JP | 13 |
| Cambridge, US | 13 |
| Shanghai, CN | 13 |
| Fairfax, US | 13 |
| Osaka, JP | 13 |
| Korea National Arboretumlocation not on record | 12 |
| SLU Artdatabankenlocation not on record | 12 |
| St. Paul, US | 12 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 11 |
| Guiyang, CN | 11 |
| University of New Hampshirelocation not on record | 11 |
| Tianjin Natural History Museumlocation not on record | 11 |
| New Brunswick, US | 11 |
| MeiseBGlocation not on record | 10 |
| University of Stellenboschlocation not on record | 10 |
| WNNUlocation not on record | 10 |
| Nanjing, CN | 10 |
| Chapel Hill, US | 10 |
| Portland, US | 10 |
| Kingston, US | 10 |
| Tsukuba, JP | 10 |
| Changsha, CN | 9 |
| Museum of the Rockieslocation not on record | 9 |
| Elocation not on record | 9 |
| Chicago, US | 9 |
| KURAlocation not on record | 9 |
| LDlocation not on record | 9 |
| Sagamihara, JP | 9 |
| Fukushima Universitylocation not on record | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| SXTCMlocation not on record | 8 |
| Seoul, KR | 8 |
| Bangkok, TH | 8 |
| FFPRIlocation not on record | 8 |
| Toronto, CA | 7 |
| Shanghai, CN | 7 |
| Peking Universitylocation not on record | 7 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 7 |
| Beijing, CN | 7 |
| Morgantown, US | 7 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 6 |
| Hudson, US | 6 |
| Plocation not on record | 6 |
| DMZ botanic gardenlocation not on record | 6 |
| Guangzhou, CN | 6 |
| WTUlocation not on record | 6 |
| Little Rock, US | 6 |
| Columbia, US | 6 |
| Kushiro City Museumlocation not on record | 6 |
| Western Carolina Universitylocation not on record | 6 |
| Lincoln, US | 5 |
| 湖北神农架林区标本馆location not on record | 5 |
| Angwin, US | 5 |
| Awka, NG | 5 |
| Williamsburg, US | 5 |
| Riverside, US | 5 |
| University of Tennessee at Chattanoogalocation not on record | 5 |
| Emporia, US | 5 |
| Chongqing, CN | 4 |
| Tomioka, JP | 4 |
| Port Elizabeth Museum (Bayworld)location not on record | 4 |
| Taipei, TW | 4 |
| Cincinnati, US | 4 |
| Green Bay, US | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Nanjing, CN | 4 |
| Clemson, US | 4 |
| Montréal, CA | 4 |
| Wlocation not on record | 4 |
| Oskarshamn, SE | 4 |
| Henderson State Universitylocation not on record | 4 |
| Guiyang, CN | 3 |
| Royal Botanical Gardenslocation not on record | 3 |
| Tampa, US | 3 |
| Berlin, DE | 3 |
| Jishou Universitylocation not on record | 3 |
| Parthenon Tama History Museumlocation not on record | 3 |
| Fort Worth, US | 3 |
| Claremont, US | 3 |
| Zhejiang Museum of Natural Historylocation not on record | 3 |
| Fujian Institute of Subtropical Botanylocation not on record | 3 |
| Jiangxi College of Educationlocation not on record | 3 |
| Museo universitario di Chietilocation not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Toyota city nature sanctuarylocation not on record | 3 |
| Davenport, US | 3 |
| ENTClocation not on record | 3 |
| Chongqing Natural History Museumlocation not on record | 2 |
| Qufu Normal Universitylocation not on record | 2 |
| Johnson City, US | 2 |
| Asheville, US | 2 |
| Akita Prefectural Museumlocation not on record | 2 |
| GNWPlocation not on record | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| Irkutsk State Universitylocation not on record | 2 |
| ifplocation not on record | 2 |
| Kawasaki Shi Tama Ku, JP | 2 |
| Kagoshima, JP | 2 |
| Macomb, US | 2 |
| Edmonton, CA | 2 |
| Yunnan Universitylocation not on record | 2 |
| Dover, US | 2 |
| BAYLUlocation not on record | 2 |
| Minia, EG | 2 |
| Chadron, US | 2 |
| Harrisonburg, US | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| Washington, US | 2 |
| Denver, US | 2 |
| Hebei Normal Universitylocation not on record | 2 |
| Provo, US | 2 |
| Waverly, US | 2 |
| KIWElocation not on record | 2 |
| Podgorica, ME | 2 |
| GAlocation not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Pittsburg, US | 2 |
| Guiyang, CN | 2 |
| Obihiro Centennial City Museumlocation not on record | 2 |
| Jackson, US | 2 |
| Fayetteville, US | 2 |
| MAlocation not on record | 1 |
| Norfolk, US | 1 |
| Xiamen, CN | 1 |
| SCAUlocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| J. Rusek Collectionlocation not on record | 1 |
| DNSMlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| Capital Normal Universitylocation not on record | 1 |
| San Sebastián, ES | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Corvallis, US | 1 |
| SJNAlocation not on record | 1 |
| Guizhou Forestry Schoollocation not on record | 1 |
| Tempe, US | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Long Beach, US | 1 |
| Durham, US | 1 |
| BJUlocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Bothell, US | 1 |
| Miami, US | 1 |
| Moscow, US | 1 |
| Central Botanical Gardenlocation not on record | 1 |
| SXPHClocation not on record | 1 |
| Wuhan, CN | 1 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 1 |
| Shenzhen, CN | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| SDFlocation not on record | 1 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 1 |
| Acadia Universitylocation not on record | 1 |
| Boise, US | 1 |
| Nanchong, CN | 1 |
| Salvador, BR | 1 |
| Pullman, US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Vitoria, ES | 1 |
| US | 1 |
| Whitewater, US | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Northridge, US | 1 |
| Durham, US | 1 |
| SSNHlocation not on record | 1 |
| Vancouver, CA | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Logan, US | 1 |
| Mount Pleasant, US | 1 |
| Dekalb, US | 1 |
| Tartu, EE | 1 |
| PRClocation not on record | 1 |
| KNAMlocation not on record | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Staten Island, US | 1 |
| Mlocation not on record | 1 |
| Smithsonian Institutionlocation not on record | 1 |
| Hamilton, US | 1 |
| Otaru, JP | 1 |
| KOMlocation not on record | 1 |
| Santa Barbara, US | 1 |
| Oswego, US | 1 |
| Salzburg, AT | 1 |
| 湖北神农架国家级自然保护区location not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Springfield, US | 1 |
245 institutions · 4 892 of 5 087 vouchered records shown · 195 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA42 detections
Where the DNA of Euonymus alatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found42
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 42 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.9 °C 13.9–23.5
Seasonal swing summer↔winter24.7 °C
Max temp (day)22.2 °C 17.0–26.2
Min temp (night)14.6 °C 10.2–20.5
Precipitation228 mm/mo 146–344
Air humidity63.9 % 59.8–66.8
Moisture balance91.8 mm/mo 23.5–262
Vapour deficit794 Pa 554–1,059
Wind speed2.60 m/s 1.90–3.90
Cloud cover42.5 % 35.3–49.5
CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.