Euodia hylandii

T.G.Hartley · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Euodia

At a glance

Occurrence records145

Data sources7

Biological traits18

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Euodia hylandii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility145 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF145 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Evodia hylandii là một loài thực vật có hoa trong họ Cửu lý hương. Loài này được T.G.Hartley mô tả khoa học đầu tiên năm 2001.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology7

Fruit length5 mm

Leaf length120 mm

Leaf width40 mm

Petiole length1.25 cm

Plant height6 m

Seed length2 mm

Seed width2 mm

Life cycle & reproduction4

Flowering timeyyyyyynnnnnn

Life formshrub or tree

Life spanperennial

Sex typehermaphrodite

Habitat & environment7

Climateseasonally dry tropical

Fruit fleshinessdry

Fruit typefollicle

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

03Chemical composition2 compounds

Compounds documented for Euodia hylandii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Humulane sesquiterpenoids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(1R,3Z,7Z,11S)-1,5,5,8-tetramethyl-12-oxabicyclo[9.1.0]dodeca-3,7-diene		present	LOTUS
12-Oxabicyclo[9.1.0]dodeca-3,7-diene, 1,5,5,8-tetramethyl-, (1R,3E,7E,11R)-		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euodia hylandii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ225814.1 ↗422 bp

ACGT

GGATCGCGGCGACGCGGGCGGTTCGCTGCCTGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAA …

Euodia hylandii isolate 8885 internal transcribed spacer 1, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type145 records

Wild obs. + sensor17

Museum / vouchered127

Other1

Origin

Native5

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 3≤1 km 3≤10 km 7

13 georeferenced · 4 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 29≤1 km 20≤10 km 59>10 km 2

110 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence127

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	63
Brisbane, AU	25
Canberra, AU	12
Museo Entomologico de Leonlocation not on record	5
Mount Annan, AU	4
Palmerston, AU	4
James Cook Townsvillelocation not on record	1
Kew, GB	1
Adelaide, AU	1
Armidale, AU	1
ASUlocation not on record	1
Auckland, NZ	1

12 institutions · 119 of 127 vouchered records shown · 7 without an institution code

09Environmental DNA2 detections

Where the DNA of Euodia hylandii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)