Eulophia petersii

(Rchb.f.) Rchb.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Eulophia

At a glance

Occurrence records304

Data sources10

Biological traits16

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Eulophia petersii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility304 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF304 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Eulophia petersii is a succulent species of flowering plant in the family Orchidaceae, from southern and eastern Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max2 m

Plant height min0.8 m

Seed mass0.005 mg

Life cycle & reproduction3

Life formpseudobulbous geophyte or lithophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 220 m

Elevation min106 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Eulophia petersii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Phenanthrenes1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Eulophiol		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eulophia petersii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSLN831410.1 ↗579 bpZambia

ACGT

GAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGAC …

Eulophia petersii genomic DNA sequence contains 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2, 28S rRNA gene, specimen voucher Bone, R.E., & Bingham, M. RB309, K, UZL, K DNA 44454

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eulophia petersii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 481×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Aoyama, M. 1989. Karyomorphological studies in Cymbidium and its allied genera, Orchidaceae. Bull. Hiroshima Bot. Gard. 11: 1–121.

n 241×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — HALL, A.V. 1965. studies in the genus Eulophia. J. s. African Bot. Suppl. Vol. 5: 1-248.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type304 records

Wild obs. + sensor196

Museum / vouchered108

Range

Area of Occupancy AOO856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 96≤1 km 19≤10 km 9>10 km 13

137 georeferenced · 59 without coordinates

Open the mapobservation + sensor196

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 2≤10 km 2

4 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	42
Durban, ZA	14
Instituto de Investigação Científica Tropicallocation not on record	7
Berlin, DE	5
Cape Town, ZA	4
MeiseBGlocation not on record	4
Uppsala, SE	3
South Kensington, GB	3
National Museums of Kenyalocation not on record	2
Stockholm, SE	1
TAFORI-LSRClocation not on record	1
South African National Biodiversity Institutelocation not on record	1
Wlocation not on record	1
LNBG$location not on record	1

14 institutions · 89 of 108 vouchered records shown · 19 without an institution code

09Environmental DNA3 detections

Where the DNA of Eulophia petersii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)