Eulophia nuda

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Eulophia

At a glance

Occurrence records68

Data sources11

Biological traits20

DNA specimens13

eDNA detections12

Sources11 archives

Databases and archives Eulophia nuda's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Chemical compositionLOTUS · NPASS23 compounds

Occurrence & distributionGBIF68 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB2n = 54

01Narrative

Eulophia nuda, the spectacular eulophia, is a species of corduroy orchid found in tropical and subtropical Asia to the Western Pacific.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology3

Leaf length375 mm

Leaf width52.5 mm

Plant height max1 m

Life cycle & reproduction4

Dispersal typewind

Life formpseudobulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max2 400 m

Elevation min600 m

Epiphyteterrestrial

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate

Succulenceno

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition23 compounds

Compounds documented for Eulophia nuda across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Phenanthrenes13

Phenylalanine-derived alkaloids5

Hydrocarbons1

Fatty alcohols1

Shikimic acids and derivatives $ Simple phenolic acids1

Documented compounds23 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2R)-2-amino-1-phenylpropan-1-ol	present	NPASS
1,5,7-Trimethoxy-9,10-dihydrophenanthrene-2,6-diol	present	LOTUS
1-(4-Hydroxy-benzyl)-4,8-dimethoxy-phenanthrene-2,7-diol	present	LOTUS
1-Methoxyphenanthrene-2,7-diol	present	LOTUS
2,6-Phenanthrenediol, 1,5,7-trimethoxy-	present	LOTUS
2,7-Dihydroxy-4,8-dimethoxy-9,10-dihydrophenanthrene	present	LOTUS
3,7-Dihydroxy-2,4-dimethoxyphenanthrene	present	LOTUS
4,4',8,8'-Tetramethoxy[1,1'-biphenanthrene]-2,2',7,7'-tetrol	present	LOTUS
4-[2-(3-Hydroxy-5-methoxyphenyl)ethyl]-2,6-dimethoxyphenol	present	LOTUS
4-Hydroxybenzaldehyde	present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eulophia nuda has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes2

GenBank sequences10

eDNA detections12

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJN005461.1 ↗627 bp

ACGT

CTAAAGCAAGCGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTACTATACTCCTGACTACGAAACCAAAGATACTGATATCT …

Eulophia spectabilis voucher SBB-0957 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Eulophia nuda carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidydiploid inferred

Chromosome records32–542n range54median54mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 544×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol2 +1

CCDB · ipcn-api-dl — Singh, F. 1981. ln Chromosome number reports LXXII. Taxon 30: 704–705.

CCDB · book-ipcn67-71 — CHATTERJI, A.K. 1965. Chromosomes of Eulophia. Chromosome Inf. Serv. 6: 8-9.

CCDB · book-indian_vol2 — Chatterji, A.K. 1965 ; Vij, S.P. & Mehra, P.N. 1976

CCDB · eflora

2n 322×CCDB · book-ipcn65 · CCDB · book-fedorov

CCDB · book-ipcn65 — Pancho 1965a

CCDB · book-fedorov — Pancho (C. n. III. 1965)

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.997 ↗

08Occurrence & distribution

Record type68 records

Wild obs. + sensor50

Museum / vouchered17

Other1

Range

Area of Occupancy AOO232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 6≤1 km 7≤10 km 12>10 km 14

39 georeferenced · 11 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	3
Cibinong Science Center, Herbarium Bogorienselocation not on record	3
Bronx, US	2
Dresden, DE	1
Xiamen, CN	1
Moscow State Universitylocation not on record	1
Nanjing, CN	1
Edinburgh, GB	1

8 institutions · 13 of 17 vouchered records shown · 4 without an institution code

09Environmental DNA12 detections

Where the DNA of Eulophia nuda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C

Min temp (night)22.6 °C

Precipitation269 mm/mo

Air humidity68.1 %

Moisture balance133 mm/mo

Vapour deficit1,080 Pa

Wind speed1.20 m/s

Cloud cover57.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)