Eulophia graminea

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Eulophia

At a glance

Occurrence records1 941

Data sources10

Biological traits19

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Eulophia graminea's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 941 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources19 traits

Occurrence & distributionGBIF1 941 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 56

01Narrative

Eulophia graminea, the Chinese crown orchid, is a species of orchid native to Asia. It often develops a pseudobulb. It is considered invasive in Florida and spreads with wood chip mulch. Flowers are green and brownish purple.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology4

Leaf length150 mm

Leaf width11.5 mm

Plant height0.8 m

Plant height max0.8 m

Life cycle & reproduction3

Life formpseudobulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max2 000 m

Elevation min300 m

Epiphyteterrestrial

Growth formherb

Leaf compoundnesssimple

Leaf shapenarrowly_lanceolate

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eulophia graminea has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences10

eDNA detections2

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPX474689.1 ↗576 bpIndia · 2024

ACGT

TTGCCGTCGCGGAACATCCGTCACAGTCGTTGCCTCGTCTCCTTTGGTGGGGGCCGCGCGACGACGGGCGAAAAAAAATTCAAACCGACG …

Eulophia graminea voucher DRLHR1029 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL2★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eulophia graminea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Ploidydiploid inferred

Chromosome records54–562n range56median56mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 565×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-indian_vol2 +1

CCDB · book-ipcn65 — Tanaka 1965a

CCDB · ipcn-api-dl — Biswas, B. K. 1978. Chromosome studies in the tribe Karosphaereae on the family Orchidaceae. Proc. Indian Sci. Congr. Assoc. (III, C) 65:93.

CCDB · ipcn-api-dl — Biswas, B. K. 1980b. In IOPB chromosome number reports LXVI. Taxon 29: 169.

CCDB · book-indian_vol2 — Biswas, B.K. 1978, 1980c

CCDB · book-fedorov — Tanaka R. 1965b

2n 541×CCDB · book-indian_vol2

CCDB · book-indian_vol2 — Mehra, P.N. & Sehgal, R.N. 1975

n 271×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Mehra & Sehgel 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.988 ↗

08Occurrence & distribution

Record type1 941 records

Wild obs. + sensor1 828

Museum / vouchered111

Cultivated / captive1

Other1

Origin

Native8

Introduced6

Range

Area of Occupancy AOO5 568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1 112≤1 km 138≤10 km 43>10 km 266

1 559 georeferenced · 269 without coordinates

Open the mapobservation + sensor1 828

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 13≤1 km 8≤10 km 10>10 km 1

32 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence111

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	19
Palmerston, AU	13
Taipei, TW	7
Canberra, AU	6
Nishihara, JP	5
Bronx, US	5
South Kensington, GB	5
TAIElocation not on record	4
Brisbane, AU	3
Taipei, TW	3
Guangzhou, CN	3
Saint Louis, US	3
Fort Worth, US	2
Guangzhou, CN	2
Tsukuba, JP	2
Columbia, US	2
Smithfield, AU	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Jena Microbial Resource Collectionlocation not on record	1
Austin, US	1
Zhengzhou, CN	1
Adelaide, AU	1
Cambridge University Herbariumlocation not on record	1
Guilin, CN	1
Cibinong, ID	1
Chapel Hill, US	1
Xiamen, CN	1
Beijing, CN	1

28 institutions · 97 of 111 vouchered records shown · 14 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Eulophia graminea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eulophia graminea

At a glance

Sources10 archives

Size & morphology4

Life cycle & reproduction3

Diet & foraging1

Habitat & environment10

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 941 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions24 of 28 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 941 records