Eulobus californicus

Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Eulobus

At a glance

Occurrence records4 107

Data sources8

Biological traits16

DNA specimens4

eDNA detections2

Sources8 archives

Databases and archives Eulobus californicus's data was compiled from.

GBIFGlobal Biodiversity Information Facility4 107 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF4 107 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceGoaTgenome

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.224 mg

Seed mass max0.314 mg

Seed mass min0.16 mg

Life cycle & reproduction4

Dispersal typeunspecialized

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Mycorrhiza type0.00000229

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eulobus californicus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY271597.1 ↗600 bp

ACGT

TCGTATCCTGCACAGCAGAACAACCCGAGAACCGGTTAACAACCACTTGGGAGACAGGGGCATGTCCCATGCGCTCCCAAATCCCGCTGT …

Camissonia californica internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Eulobus californicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.940 ↗

08Occurrence & distribution

Record type4 107 records

Wild obs. + sensor4 012

Museum / vouchered95

Range

Area of Occupancy AOO6 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 2 222≤1 km 244≤10 km 100>10 km 56

2 622 georeferenced · 1 390 without coordinates

Open the mapobservation + sensor4 012

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 76≤1 km 1≤10 km 3

80 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	62
Los Angeles, US	15
Wuzhou, CN	5
ASUlocation not on record	4
Austin, US	3
Severin-McDaniel Insect Collectionlocation not on record	2
San Juan College School of Science Math & Engineeringlocation not on record	1
Ensenada, MX	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Claremont, US	1

10 institutions · 95 of 95 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Eulobus californicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 21.6–21.6

Seasonal swing summer↔winter19.9 °C

Max temp (day)28.1 °C

Min temp (night)14.8 °C

Precipitation4.50 mm/mo

Air humidity40.2 %

Moisture balance-177 mm/mo

Vapour deficit1,546 Pa

Wind speed4.30 m/s

Cloud cover35.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eulobus californicus

At a glance

Sources8 archives

Size & morphology3

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 107 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 107 records