Eulepidotis juncida

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Eulepidotis

At a glance

Occurrence records962

Data sources4

Biological traits0

DNA specimens174

eDNA detections172

Sources4 archives

Databases and archives Eulepidotis juncida's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility962 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI172 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics174 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF962 records

Environmental DNA1 datasets · 6 countries172 detections

DNA & barcodingBOLD174 specimens

01Narrative

Eulepidotis juncida is een vlinder uit de familie van de spinneruilen (Erebidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1852 door Guenée.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding174 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eulepidotis juncida has left across the world's sequence archives.

At a glance

DNA specimens174

BINs3

Marker genes1

eDNA detections172

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus168 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

202Amostly conserved

232Cvariable

364Tmostly conserved

AACTTTATATTTTATCTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTCTAAGATTATTAATTCGAGCTGAATTAGGGAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.32%

Haplotypes26

BINs3

Most divergent pair3.5%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eulepidotis addenssame genus1.8%Eulepidotis striaepunctasame genus1.8%Eulepidotis juliatassame genus3.2%Aegle agathasame order6.1%Negritothripa hampsonisame order6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type962 records

Wild obs. + sensor165

Museum / vouchered797

Range

Area of Occupancy AOO824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 72≤1 km 23≤10 km 19>10 km 4

118 georeferenced · 47 without coordinates

Open the mapobservation + sensor165

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 3≤10 km 11>10 km 13

27 georeferenced · 770 without coordinates

Open the institutions mapphysical evidence797

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	724
Cambridge, US	23
St. Paul, US	4
ZSMlocation not on record	3
Bavarian State Collection of Zoologylocation not on record	3
Ciudad de México, MX	2
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
University of Pennsylvanialocation not on record	1
Mississippi State, US	1
Area de Conservacion Guanacastelocation not on record	1
East Lansing, US	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
MZLUlocation not on record	1

13 institutions · 767 of 797 vouchered records shown · 30 without an institution code

09Environmental DNA172 detections

Where the DNA of Eulepidotis juncida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found172

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 172 detections have coordinates

Open the map6 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 23.1–25.7

Seasonal swing summer↔winter2.40 °C

Max temp (day)26.8 °C 26.0–29.2

Min temp (night)22.2 °C 20.2–23.9

Precipitation247 mm/mo 44.2–403

Air humidity69.2 % 61.2–74.2

Moisture balance95.9 mm/mo -102–264

Vapour deficit916 Pa 798–1,260

Wind speed2.90 m/s 1.70–5.30

Cloud cover34.2 % 16.2–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 166 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)