Eugenia victoriana

Cuatrec. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Eugenia

At a glance

Occurrence records41

Data sources6

Biological traits13

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Eugenia victoriana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources13 traits

Occurrence & distributionGBIF41 records

DNA & barcodingNCBIsequences

01Narrative

Eugenia victoriana is a small South American fruit tree of the genus Eugenia. Its common names include guayabilla and sundrop. Eugenia victoriana has the largest fruit of all known Eugenia species. The tree first flowers in its third or fourth year. The fruits are orange-colored, and have sour flesh and two to four large seeds.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height2.5 m

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation mean50 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eugenia victoriana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP024598.1 ↗669 bpSingapore

ACGT

AGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCC …

Eugenia victoriana voucher Vasconcelos, 717 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type41 records

Wild obs. + sensor22

Museum / vouchered19

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 21 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 1≤10 km 8

9 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad de Antioquia (UdeA)location not on record	7
Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record	3
Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record	2
Museu Paraense Emílio Goeldilocation not on record	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Universidad de Caldas (UCaldas)location not on record	1
Saint Louis, US	1
Universidad Industrial de Santander (UIS)location not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1
arosemena tola, EC	1

10 institutions · 19 of 19 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)