Eugenia pitanga

(O.Berg) Nied. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Eugenia

At a glance

Occurrence records253

Data sources8

Biological traits16

DNA specimens0

eDNA detections6

Sources8 archives

Databases and archives Eugenia pitanga's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility253 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF253 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 44

01Narrative

Conhecida como pitanga-do-cerrado, é uma espécie pouco conhecida de pitanga, diferente da Eugenia uniflora, essa pitanga é um arbusto de rizomatoso do cerrado. Seus frutos também são muito apreciados pelos humanos.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height2 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 100 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Habitat GIFTBosque alto, bosque bajo on saturated soil

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eugenia pitanga has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP037981.1 ↗660 bpBrazil

ACGT

TAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCCTAGCAGAATGACCAGAGAAC …

Eugenia pitanga voucher Faria, 4112 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Eugenia pitanga carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidydiploid inferred

Chromosome records22–442n range33median44mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 26

2n 441×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 26

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type253 records

Wild obs. + sensor5

Museum / vouchered240

Other8

Origin

Native153

Range

Area of Occupancy AOO460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 2 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 240 records without

Open the institutions mapphysical evidence240

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Jose State University, Museum of Birds and Mammalslocation not on record	46
UnBlocation not on record	29
UNESP-FCAlocation not on record	20
UNESP-ISlocation not on record	19
Ivano-Frankivsk, UA	16
UFMSlocation not on record	13
Universidade Federale do Rio Grande do Sullocation not on record	11
UFSCarlocation not on record	10
Brasília, BR	8
UNICAMPlocation not on record	7
Kew, GB	6
FUVATESlocation not on record	5
Campo Mourão, BR	4
University of Stellenboschlocation not on record	4
USP-IBlocation not on record	4
UTFPR-CPlocation not on record	4
Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record	4
JBRJlocation not on record	2
Blumenau, BR	2
Maringá, BR	2
Ural Federal University "B. N. Yeltsin"location not on record	2
Uberlândia, BR	2
Universidade Federal do Ceara, Departamento de Biologialocation not on record	1
UNESClocation not on record	1
UFABClocation not on record	1
UNESP-IBILCElocation not on record	1
Beijing, CN	1
Universidade Federal de Santa Catarinalocation not on record	1
Criciúma, BR	1
UEMAlocation not on record	1
Lake Charles, US	1
UFMGlocation not on record	1
Wlocation not on record	1
UTFPR-DVlocation not on record	1
Bronx, US	1
Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record	1

36 institutions · 234 of 240 vouchered records shown · 6 without an institution code

09Environmental DNA6 detections

Where the DNA of Eugenia pitanga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 21.0–21.0

Seasonal swing summer↔winter12.3 °C

Max temp (day)25.9 °C

Min temp (night)16.1 °C

Precipitation167 mm/mo

Air humidity58.7 %

Moisture balance9.90 mm/mo

Vapour deficit1,021 Pa

Wind speed4.70 m/s

Cloud cover36.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)